View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3739_high_30 (Length: 229)

Name: NF3739_high_30
Description: NF3739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3739_high_30
NF3739_high_30
[»] chr2 (2 HSPs)
chr2 (23-119)||(1158338-1158434)
chr2 (184-212)||(1158452-1158480)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 23 - 119
Target Start/End: Original strand, 1158338 - 1158434
Alignment:
23 ggtgggaagaaagaaaaagatgtcaagggggagtacattaaatatattgtttggtgtgaattaacgagtgaaagaggaaagaaaaggagatgttgat 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||    
1158338 ggtgggaagaaagaaaaagatgtcaagggggagtacattaaatatattgtttgatgtgaattaacgagtgaaagaggaaagaaaaagagatgttgat 1158434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 212
Target Start/End: Original strand, 1158452 - 1158480
Alignment:
184 cttcatccaattgacccggctagtatatt 212  Q
    |||||||||||||||||||||||||||||    
1158452 cttcatccaattgacccggctagtatatt 1158480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University