View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3739_high_31 (Length: 210)
Name: NF3739_high_31
Description: NF3739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3739_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 17 - 193
Target Start/End: Complemental strand, 47777819 - 47777639
Alignment:
| Q |
17 |
cacagaaatagtggaagttttgtgggttgttgttggctttggcttgattagtaaaaatgatgaatatgagtaggagattaagaagtggaaaatatttccc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47777819 |
cacagaaatagtggaagttttgtgggttgttgttggctttggcttgattagtaaaaatgatgaatatgagtaggagattaagaagtggaaaatatttccc |
47777720 |
T |
 |
| Q |
117 |
tgaaaaaataacagccatggttg----tttgtgcttaaagaatgaataatcttattgagttagagttttgggtatgcattt |
193 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47777719 |
tgaaaaaataacagccatggttgtttttttgtgcttaaagaatgaataatcttattgagttagagttttgggtatgcattt |
47777639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University