View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3739_low_21 (Length: 329)
Name: NF3739_low_21
Description: NF3739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3739_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 3284983 - 3284758
Alignment:
| Q |
18 |
caatggcacaatacaacctttgctaattaaatattcagtttcccatgccaccactatgtttagtgtatgcacctgaggtctagaaagagtctccgcaata |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3284983 |
caatggcacaatacaacctttactaattaaatattcagtttcccatgccaccactatgtttagtgtatgcacctgaggtctagaaagagtttccgcaata |
3284884 |
T |
 |
| Q |
118 |
tggaacaagcgtcatcctcgacaactagaaaatcaagacagtctcaaccgagtgagtcttcacagatgctgggaatgccagcttccattgcaaattagag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3284883 |
tggaacaagcgtcatcctcgacaactagaaaatcaagacagtctcaaccgagcgagtcttcacagatgctgggaatgccagcttccattgcaaattagag |
3284784 |
T |
 |
| Q |
218 |
aacttgacactttaaaccctatatga |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
3284783 |
aacttgacactttaaaccctatatga |
3284758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 268 - 329
Target Start/End: Original strand, 3280629 - 3280690
Alignment:
| Q |
268 |
aataagcaaactactaagtactaaccatcgtttgtatttgttgacaatggatattgcataaa |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3280629 |
aataagcaaactactaagtactaaccatcgtttgtatttgttgacaatggatattgcataaa |
3280690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 290 - 329
Target Start/End: Original strand, 3275769 - 3275808
Alignment:
| Q |
290 |
aaccatcgtttgtatttgttgacaatggatattgcataaa |
329 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
3275769 |
aaccattgtttgtatttgctgacaatggatattgcataaa |
3275808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University