View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3739_low_25 (Length: 260)
Name: NF3739_low_25
Description: NF3739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3739_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 10 - 243
Target Start/End: Complemental strand, 11623239 - 11623027
Alignment:
| Q |
10 |
cttgtcatattcatgtctcttgtgcacttacaaatctacattatgagggaatcatcaatttgatccttaaatttcgacaatggtagtttgatcctagaac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11623239 |
cttgtcatattcatgtctcttgtgcacttacaaatctacattatgagggaatcatcaatttgatccttaaatttcgacaatggtagtttgatcctagaac |
11623140 |
T |
 |
| Q |
110 |
taaaataaattcaaagagaatttaaggaattgtaaattgtagcttattttagcattaaatcttagtattttgaattttaggtgatattttataattgaac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11623139 |
taaaataaattcaaagagaatttaaggaattgtaaattgtagcttat---------------------tttgaattttaggtgatattttataattgaac |
11623061 |
T |
 |
| Q |
210 |
ttttaaaaactattgtgttttttatataacctga |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11623060 |
ttttaaaaactattgtgttttttatataacctga |
11623027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University