View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3739_low_26 (Length: 259)
Name: NF3739_low_26
Description: NF3739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3739_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 244
Target Start/End: Original strand, 5769510 - 5769740
Alignment:
| Q |
14 |
tcatcagcaaccactgcagcatagaaatagttcttnnnnnnntttattcttaaatttgcataaattagaacaattttccagaattattggtttacataat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5769510 |
tcatcagcaaccactgcagcatagaaatagttcttaaaaaaatttattcttaaatttgcataaattagaacaattttccagaattactggtttacataat |
5769609 |
T |
 |
| Q |
114 |
cacaaggcatgaatgagttaaattcattttggttgcataaattgattcatttagttgcaaccccatttgattgggggaaatggaatttgggatgagacaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5769610 |
aacaaggcatgaatgagttaaattcattttggttgcataaattgattcatttagttgcaaccccatttgattgggggaaatggaatttgggatgagacaa |
5769709 |
T |
 |
| Q |
214 |
tggtgttctacgtttgacagtgatttggatc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5769710 |
tggtgttctacgtttgacagtgatttggatc |
5769740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University