View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3739_low_28 (Length: 243)
Name: NF3739_low_28
Description: NF3739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3739_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 126 - 226
Target Start/End: Original strand, 35037716 - 35037816
Alignment:
| Q |
126 |
ttgcagggtcaaatgggatgaatgatctctactcctccagccagtccattacagaaaagaacatattgtaagtttgacgcagtttgtcagttccaccacg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35037716 |
ttgcagggtcaaatgggatgaatgatctctactcctccagccagtccattacatagaagaacatattgtaagtttgacgcagtttgtcagttccaccacg |
35037815 |
T |
|
| Q |
226 |
t |
226 |
Q |
| |
|
| |
|
|
| T |
35037816 |
t |
35037816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 4 - 64
Target Start/End: Original strand, 35037659 - 35037719
Alignment:
| Q |
4 |
tacatattttgttcttattagttatgttgatacttaatacataatttattcctctagttgc |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35037659 |
tacatattttgttcttattagttatgttgatacttaatacataatttattcctctagttgc |
35037719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University