View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3739_low_32 (Length: 229)
Name: NF3739_low_32
Description: NF3739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3739_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 23 - 119
Target Start/End: Original strand, 1158338 - 1158434
Alignment:
| Q |
23 |
ggtgggaagaaagaaaaagatgtcaagggggagtacattaaatatattgtttggtgtgaattaacgagtgaaagaggaaagaaaaggagatgttgat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1158338 |
ggtgggaagaaagaaaaagatgtcaagggggagtacattaaatatattgtttgatgtgaattaacgagtgaaagaggaaagaaaaagagatgttgat |
1158434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 212
Target Start/End: Original strand, 1158452 - 1158480
Alignment:
| Q |
184 |
cttcatccaattgacccggctagtatatt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1158452 |
cttcatccaattgacccggctagtatatt |
1158480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University