View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3740_high_11 (Length: 269)
Name: NF3740_high_11
Description: NF3740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3740_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 9336527 - 9336312
Alignment:
| Q |
1 |
cacaagaacattaatcagaagagtgaagaccaaaaccagctggacaacaatgttgatgaacgagttacttgtactcactctcattttcgatatgatctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9336527 |
cacaagaacattaatcagaagagtgaagaccaaaaccagctggacaacaatgttgatgaacgagttacttgtactcactctcattttcgatatgatctat |
9336428 |
T |
 |
| Q |
101 |
tattaatctttgcagttcaaggnnnnnnngaatgttcctgaataaatgatcgcatatatcctaaccaaatatccctcaataatgaatacatgacacgtat |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
9336427 |
tattaatctttgcagttcaaggaaaaaaagaatgttcctgaataaatgatcgcatatatcctaaccaaatatccctcaacaatgaatacatgacacatat |
9336328 |
T |
 |
| Q |
201 |
acttataccagggact |
216 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
9336327 |
acttataccagagact |
9336312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 216 - 253
Target Start/End: Original strand, 4903301 - 4903338
Alignment:
| Q |
216 |
ttacttcttcatgatttgctcgaggatttgaatgggtt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4903301 |
ttacttcttcatgatttgctcgaggatttgaatgggtt |
4903338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University