View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3740_high_13 (Length: 262)

Name: NF3740_high_13
Description: NF3740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3740_high_13
NF3740_high_13
[»] chr7 (1 HSPs)
chr7 (11-246)||(3488510-3488745)


Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 11 - 246
Target Start/End: Original strand, 3488510 - 3488745
Alignment:
11 caaaggtacgtgttctttttaaactatgatatttgtgagaaaattattgggttctttgaaatatgtgattttgttttgagttttgaaaaaagggtttcaa 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
3488510 caaaggtacgtgttctttttaaactatgatatttgtgagaaaattattgggttctttgaaatatgtgattttg-tttgagttttgaaaaaagggtttcaa 3488608  T
111 agtataccctttttcttgaacctgtttcgtgttttacatgagtttccatgg-nnnnnnnnnnnnnnnnngatgtgggcttgctgaggaattagtttaagg 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||                  |||||||||||||||||||||||||||||||    
3488609 agtataccctttttcttgaacctgtttcgtgttttacatgagtttcgatggttttttttgtagttttttgatgtgggcttgctgaggaattagtttaagg 3488708  T
210 tgagtttctttttatgcttttcttttatgaatataat 246  Q
    |||||||||||||||| |||| |||||||||||||||    
3488709 tgagtttctttttatgtttttgttttatgaatataat 3488745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University