View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3740_high_13 (Length: 262)
Name: NF3740_high_13
Description: NF3740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3740_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 11 - 246
Target Start/End: Original strand, 3488510 - 3488745
Alignment:
| Q |
11 |
caaaggtacgtgttctttttaaactatgatatttgtgagaaaattattgggttctttgaaatatgtgattttgttttgagttttgaaaaaagggtttcaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3488510 |
caaaggtacgtgttctttttaaactatgatatttgtgagaaaattattgggttctttgaaatatgtgattttg-tttgagttttgaaaaaagggtttcaa |
3488608 |
T |
 |
| Q |
111 |
agtataccctttttcttgaacctgtttcgtgttttacatgagtttccatgg-nnnnnnnnnnnnnnnnngatgtgggcttgctgaggaattagtttaagg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3488609 |
agtataccctttttcttgaacctgtttcgtgttttacatgagtttcgatggttttttttgtagttttttgatgtgggcttgctgaggaattagtttaagg |
3488708 |
T |
 |
| Q |
210 |
tgagtttctttttatgcttttcttttatgaatataat |
246 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
3488709 |
tgagtttctttttatgtttttgttttatgaatataat |
3488745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University