View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3740_low_17 (Length: 254)
Name: NF3740_low_17
Description: NF3740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3740_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 93 - 240
Target Start/End: Original strand, 28478884 - 28479031
Alignment:
| Q |
93 |
aaatgaataatgaaatgatgtggcaaaagatgtggcgtatggaaagtatttggaattatttgataatgtgtgatttctttgtgttctgattggttggtga |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28478884 |
aaatgaataatgaaatgatgtggcaaaagatgtggcgtatggaaagtttttggaattatttgagaatgtgtgatttctttgtgttctgattggttggtga |
28478983 |
T |
 |
| Q |
193 |
gtacacgttttatccacactccttcaattctatcatcatccctctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28478984 |
gtacacgttttatccacactccttcaattctatcatcatccctctctg |
28479031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 5 - 36
Target Start/End: Original strand, 28478796 - 28478827
Alignment:
| Q |
5 |
aataatagtaatatgttacttggaactaaaac |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28478796 |
aataatagtaatatgttacttggaactaaaac |
28478827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University