View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3740_low_20 (Length: 239)
Name: NF3740_low_20
Description: NF3740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3740_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 83 - 230
Target Start/End: Original strand, 1202443 - 1202590
Alignment:
| Q |
83 |
ttcaggttcaggttcaaaatgaaactctctcaatctagtaagtatgtgtgtagtctacttccaggtagtttggaagtgaggtattcagttcaaaaatttg |
182 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1202443 |
ttcaggttcagattcaaaatgaaactctctcaatctagtaagtatgtgtgtagtctacttccaggtagtttggaagtgaggtattcagttcaaaaatttg |
1202542 |
T |
 |
| Q |
183 |
atagttcttcttagttaataaatttatatttttctccttttgatgatg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1202543 |
atagttcttcttagttaataaatttatatttttctccttttgatgatg |
1202590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University