View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3741_low_1 (Length: 376)
Name: NF3741_low_1
Description: NF3741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3741_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 4 - 245
Target Start/End: Complemental strand, 35899245 - 35899004
Alignment:
| Q |
4 |
tgtccgaaagatgattcaattatttcattttctctcaaattattaatggtatcaatgtcgtgttcgattttataatttgtgtctgcatatttgtatagtg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35899245 |
tgtccgaaagatgattcaattatttcattttctctcaaattattaatggtatcaatgtcgtgttcaattttataatttgtgtctgcatatttgtatagtg |
35899146 |
T |
|
| Q |
104 |
ttgtgtccagtgttcgtgtgtatactacacataacacaattgtttcgatattgctatttcacatcataatgcacagtgataataaggaatacatgccaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35899145 |
ttgtgtccagtgttcgtgtgtatactacacataacacaattgtttcgatattgctatttcacatcataatgcacagtgataataaggaatacataccaat |
35899046 |
T |
|
| Q |
204 |
catgttacagcctttggatttaagttcttcatatctatgctg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35899045 |
catgttacagcctttggatttaagttcttcatatctatgctg |
35899004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 283 - 358
Target Start/End: Complemental strand, 35898967 - 35898892
Alignment:
| Q |
283 |
tcatatcctatcggagagtgatattgatgatcatgcgcaagaaatttgaaatggaaaattgaaattacaattacgt |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35898967 |
tcatatcctatcggagagtgatattgatgatcatgcgtaagaaatttgaaatggaaaattgaaattacaattacgt |
35898892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University