View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3742_high_9 (Length: 240)
Name: NF3742_high_9
Description: NF3742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3742_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 23 - 187
Target Start/End: Original strand, 40925872 - 40926032
Alignment:
| Q |
23 |
aattccgtggcctataaaaaattgaagtctttgctggtcagaatcttttcaaggtggcaggagcagatcaattcaacacttgacttacgtggtgtacgtt |
122 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40925872 |
aattccgtggcgtataaaaaattgaagtctttgctggtcagaatcttttcaaggtggcaggagcagatcaattcaacacttgacttacgtggt----gtt |
40925967 |
T |
|
| Q |
123 |
gcttttaccctcactacctcaaagccaccgtcttcatcaacaccgaaacaagttgagacatggac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925968 |
gcttttaccctcactacctcaaagccaccgtcttcatcaacaccgaaacaagttgagacatggac |
40926032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 131 - 177
Target Start/End: Complemental strand, 40925699 - 40925653
Alignment:
| Q |
131 |
cctcactacctcaaagccaccgtcttcatcaacaccgaaacaagttg |
177 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
40925699 |
cctcactacctcaaacccactttcttcatcaacaccgaaacaagttg |
40925653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 109
Target Start/End: Original strand, 6716248 - 6716313
Alignment:
| Q |
43 |
attgaagtctttgctggtcagaatcttttcaaggtggcaggagcagatcaattcaacacttgactta |
109 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
6716248 |
attgaagtctttgctggtcagaat-tttcgaagatggcaggagcggattaattcaacacttgactta |
6716313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 175
Target Start/End: Complemental strand, 6717243 - 6717199
Alignment:
| Q |
131 |
cctcactacctcaaagccaccgtcttcatcaacaccgaaacaagt |
175 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
6717243 |
cctcactacctcaaagccaccttcttaatcaacatcgaaacaagt |
6717199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University