View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3743_high_23 (Length: 333)
Name: NF3743_high_23
Description: NF3743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3743_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 19 - 317
Target Start/End: Original strand, 23826851 - 23827149
Alignment:
| Q |
19 |
atcaccatactcactttccttcgttctcagcatctttctcatatgtctttactaatccatccaaacttttatagcttaagcttttagtcaagttgctcaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23826851 |
atcaccatactcactttccttcgttctcagcatctttctcatatgtctttactaatccatccaaacttttatagcttaagcttttagtctagttgctcaa |
23826950 |
T |
 |
| Q |
119 |
cttttttagtactgttatacttttcttatgacactctatcttgctatatatagcgacacttttcgcaataatggcatgtcaagtgtttgaacgtgttaat |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23826951 |
cttttttcgtactgttatacttttcttatgacactctatcttgctatatatagcgacacttttcgcaataatggcatgtcaagtgtttgaacgtgttaat |
23827050 |
T |
 |
| Q |
219 |
gtctaaaccaatactgcactgacatacgtaattacattcgattcaatcacttgcattttattaaattgttgtgtatacacgcattagtgcaatttcgtg |
317 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23827051 |
gtctaaaccaatactacactgacatacgtaattacattcgattcaatcacttgcattttattaaattgttgtgtatacacgcattagtgctatttcgtg |
23827149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 66 - 124
Target Start/End: Original strand, 23817813 - 23817871
Alignment:
| Q |
66 |
tttactaatccatccaaacttttatagcttaagcttttagtcaagttgctcaacttttt |
124 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||| ||||||| |||| |
|
|
| T |
23817813 |
tttactaatccatccaaacttttttagcttaactttttagtcaagtagctcaacctttt |
23817871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University