View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3743_high_26 (Length: 321)
Name: NF3743_high_26
Description: NF3743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3743_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 310
Target Start/End: Complemental strand, 25492558 - 25492265
Alignment:
| Q |
19 |
gctcggagccaaagttggcatagtatttggttgaagtgccactcttctcggcacctttggaacgattggcagaagtgcatttattttacatccacttcgc |
118 |
Q |
| |
|
||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
25492558 |
gctcggaacaaaagttggcatagtcattggttgaagtgccactcttctcggcacctttggaacgattggcagaattgcatttattttacatcctcttcgc |
25492459 |
T |
 |
| Q |
119 |
tcttgggtttctc-ttgtatttcaagatggaaactattgtgctaacaaaccttttttgggtcttttctaaatg-ttttacttgagggaatctaatgccta |
216 |
Q |
| |
|
||| ||||||||| ||||||||||||||||||||||||| || ||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
25492458 |
tctcgggtttctctttgtatttcaagatggaaactattgagccaacaaacctcttttgggtcttttctaaatgtttttacttgagggaatccaatgccta |
25492359 |
T |
 |
| Q |
217 |
actttattaggctagannnnnnnnnncgtaataggtttgtacttcctaattattggtttctttagttttctcttcgaagcttggatgatgtcca |
310 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
25492358 |
actttattaggctagattttttttttcgtaataggtttgaacttcctaattattggtttctttagttttctcttcgaagtttggattatgtcca |
25492265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University