View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3743_high_39 (Length: 251)
Name: NF3743_high_39
Description: NF3743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3743_high_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 180
Target Start/End: Original strand, 7601029 - 7601191
Alignment:
| Q |
18 |
aacccttccactaaactaactcgttcatattgtaatgattattctaacacatcaataacagggtaatcattaatcattaacttagttgggggcgtgaaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7601029 |
aacccttccactaaactaactcgttcatattgtaatgattattataacacatcaataacagggtaaccattaatcattaacttagttgggggcgtgaaat |
7601128 |
T |
|
| Q |
118 |
atactagtatatcatcgattcatcatcatatcatattttagattttagaacattgcttctcct |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7601129 |
atactagtatatcatcgattcatcatcatatcatattttagattttagaacattgcttctcct |
7601191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 188 - 242
Target Start/End: Original strand, 7601459 - 7601513
Alignment:
| Q |
188 |
taacattgcaatgaccccgcttgatttctttctttttatgggtctccccctttgc |
242 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7601459 |
taacgttgcaataaccccgcttgatttctttctttttatgggcctccccctttgc |
7601513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University