View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3743_low_1 (Length: 1119)
Name: NF3743_low_1
Description: NF3743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3743_low_1 |
 |  |
|
| [»] scaffold0056 (5 HSPs) |
 |  |  |
|
| [»] scaffold0026 (3 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (2 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (4 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 396; Significance: 0; HSPs: 167)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 396; E-Value: 0
Query Start/End: Original strand, 1 - 542
Target Start/End: Complemental strand, 33772385 - 33771830
Alignment:
| Q |
1 |
ccgggacctaatttagactctacaatagaaatttataannnnnnnnnnattgaggatcgaagtgtttgtaggtaacccgtgaactaattaagagatatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| || |||| ||||||||||| |
|
|
| T |
33772385 |
ccgggacctaatttagactctacaatagaaatttataattttttttt-attgaggattgaagtgtttgtaggtaacccgttaattaatcaagagatatat |
33772287 |
T |
 |
| Q |
101 |
ctagtactctttgtcaacatttcagatttgaatatgttgttgtatgataatttctccataatcagatgttgctagagtgccaatgaatgaggcgactctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33772286 |
ctagtactctttgtcaacatttcagatttgaatatgttgttgtatgataatttctcaataatcagatgttgctagagtgccaatgaatgaggcgattctg |
33772187 |
T |
 |
| Q |
201 |
gttcacttaatgttggtgttacatcctcggtcgattcctaaaaaattgtggtggagtacatgtggttggaggag---------------taagtgagcaa |
285 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||| || ||| |||||||||||||||||| |||||| |||| |
|
|
| T |
33772186 |
gttcacttaatgttggtgttatatcctcggtcggttcctaaaaaattgcgggggactacatgtggttggaggagagcaatggtgaggagtaagtgggcaa |
33772087 |
T |
 |
| Q |
286 |
tgacatagactatatggaaaattaaattgtctacttgaaggttaaagggaaggggtttgtggtacatctctgtcaaaatccattgcaatcgaggagggag |
385 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33772086 |
tgacataaattatatggaaaattaaattgtctacttgaaggttaaagggagggggtttgtggtacatctctttcaaaatccattgcaatcgaggagggag |
33771987 |
T |
 |
| Q |
386 |
aatttaagcgtagttttgggtcggcgttgatgaagggtgtggatgacatagctgagcaaacaaaaacttttctcttgtatctagggttgtggaaaatggg |
485 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33771986 |
aattaaagcgtagttttgggtcggcgttgatgaagggtgtggatgacatagctgagcaaacaaaaacttttctcttggatctagggttgtggaaaatggg |
33771887 |
T |
 |
| Q |
486 |
ttaaaagaagtaggggtagaggtgaagattttggtgattgaagataaagtatgaggt |
542 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33771886 |
ttaaaagaagtaggggtagaggtgaagatttcggtgattgaagataaagtatgaggt |
33771830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 5e-16
Query Start/End: Original strand, 982 - 1046
Target Start/End: Complemental strand, 42696209 - 42696145
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| ||||||||||||||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
42696209 |
tttaaaagctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccatgtaa |
42696145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 1497613 - 1497668
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
1497613 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaa |
1497668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 2481554 - 2481499
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
2481554 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2481499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 3172529 - 3172474
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
3172529 |
taaaatatgattttggtccttgcaaatatgcctcgttttggttttagtccatgtaa |
3172474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 4423898 - 4423953
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
4423898 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4423953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 16522994 - 16523049
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
16522994 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16523049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 16523322 - 16523267
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
16523322 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16523267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 22881616 - 22881671
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22881616 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
22881671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 25954423 - 25954368
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaa |
25954368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 29859869 - 29859814
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
29859869 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29859814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 34318080 - 34318025
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| ||||||||||||||| |
|
|
| T |
34318080 |
taaaatatggttttggtccctacaaatatgcctcgttttgattttagtccttgtaa |
34318025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 43592049 - 43592104
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
43592049 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
43592104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 146329 - 146378
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
146329 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
146378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 5334754 - 5334803
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
5334754 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
5334803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 5335037 - 5334988
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
5335037 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
5334988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 14003739 - 14003690
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
14003739 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
14003690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 15842464 - 15842513
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
15842513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 15842820 - 15842771
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
15842820 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
15842771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 20131678 - 20131629
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
20131678 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
20131629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 24358619 - 24358668
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
24358619 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
24358668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 985 - 1046
Target Start/End: Original strand, 24483397 - 24483458
Alignment:
| Q |
985 |
aaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
24483397 |
aaaagctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
24483458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 25705446 - 25705397
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
25705446 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
25705397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 29859490 - 29859539
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
29859539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 991 - 1043
Target Start/End: Original strand, 43788861 - 43788913
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
43788861 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
43788913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 1137984 - 1138039
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||| |||| ||||| |
|
|
| T |
1137984 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaa |
1138039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 1075 - 1118
Target Start/End: Complemental strand, 1295449 - 1295406
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1295449 |
ttttggttttgatccctgactccacttttgtgatgatttgcaca |
1295406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 4424182 - 4424127
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
4424182 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
4424127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 10671938 - 10671883
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
10671938 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
10671883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 13215063 - 13215118
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
13215063 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13215118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 18113092 - 18113147
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
18113092 |
taaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgtaa |
18113147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 20939322 - 20939267
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
20939322 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
20939267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 24483888 - 24483833
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
24483888 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24483833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 25705088 - 25705143
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
25705088 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
25705143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 29865508 - 29865453
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
29865508 |
taaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgtaa |
29865453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 33732865 - 33732920
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
33732865 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
33732920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 34317801 - 34317856
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
34317801 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
34317856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 42358702 - 42358757
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
42358757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 44559065 - 44559120
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
44559065 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
44559120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 44985624 - 44985679
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
44985624 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
44985679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 991 - 1041
Target Start/End: Original strand, 4042613 - 4042663
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcct |
1041 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||||||||| |
|
|
| T |
4042613 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcct |
4042663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 992 - 1046
Target Start/End: Complemental strand, 36806892 - 36806838
Alignment:
| Q |
992 |
aaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
36806838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 1497942 - 1497893
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
1497942 |
taaaatatggttttattccttgcaaatatgcctcgttttggttttagtcc |
1497893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 2481196 - 2481245
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||| ||||||||| |
|
|
| T |
2481196 |
taaaatatggttttggtacttgcaaatatgtctcgttttggttttagtcc |
2481245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 3671006 - 3671055
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3671006 |
taaaatatggttttagtccatgcaaatatgcctcgttttgattttagtcc |
3671055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 14003412 - 14003461
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
14003412 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
14003461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 16673768 - 16673719
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
16673768 |
taaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc |
16673719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 16900203 - 16900154
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
16900203 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
16900154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 16993594 - 16993545
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
16993594 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
16993545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 19184148 - 19184099
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
19184148 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
19184099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 20131320 - 20131369
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
20131320 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
20131369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 23732232 - 23732187
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
23732232 |
attttggttttggtccctgactccacttttgtgatgatttgcacac |
23732187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 24358942 - 24358893
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
24358942 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
24358893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 26814226 - 26814177
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
26814226 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
26814177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 27109076 - 27109125
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
27109076 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtcc |
27109125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 27311066 - 27311017
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
27311066 |
taaaatatggttttagtccatgcaaatatgcctcgttttggttttagtcc |
27311017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 30215425 - 30215474
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
30215425 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
30215474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 982 - 1039
Target Start/End: Original strand, 31644835 - 31644892
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||| | ||||||||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
31644835 |
tttaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
31644892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 33576114 - 33576065
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
33576114 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
33576065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 37271742 - 37271791
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
37271742 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
37271791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 37272099 - 37272050
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
37272099 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
37272050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 38980250 - 38980201
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
38980250 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
38980201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 41451840 - 41451889
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
41451840 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
41451889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 42695871 - 42695920
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
42695871 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
42695920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 44073804 - 44073755
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
44073804 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
44073755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 44559312 - 44559267
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
44559312 |
attttggttttgatccctgactccacttttctgatgatttgcacac |
44559267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1043
Target Start/End: Complemental strand, 4042887 - 4042835
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
||||||||||||| ||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
4042887 |
taaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtccttg |
4042835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 1074 - 1118
Target Start/End: Complemental strand, 37911023 - 37910979
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37911023 |
attttggttttggtccctgactccacttttgtgatgatttgcaca |
37910979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 44559406 - 44559358
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
44559406 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
44559358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1043
Target Start/End: Complemental strand, 45442693 - 45442641
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
45442693 |
taaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccttg |
45442641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 146687 - 146632
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
146687 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaa |
146632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 2265394 - 2265339
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
2265394 |
taaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgtaa |
2265339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 3172023 - 3172078
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
3172023 |
taaaatatgattttggtccctgcaaatatgcctcattttggttttagtccatgtaa |
3172078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 993 - 1040
Target Start/End: Complemental strand, 3671187 - 3671140
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3671187 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3671140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 3838261 - 3838206
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
3838261 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
3838206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 8046332 - 8046387
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
8046332 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaa |
8046387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 8046645 - 8046590
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
8046645 |
taaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
8046590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 9195203 - 9195148
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
9195203 |
taaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgtaa |
9195148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 10374777 - 10374824
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
10374777 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10374824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 10671633 - 10671688
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
10671633 |
taaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgtaa |
10671688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 11713488 - 11713543
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
11713488 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
11713543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 11713842 - 11713787
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||| |||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
11713842 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
11713787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 11788413 - 11788358
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
11788413 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
11788358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 17302140 - 17302085
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||| | |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
17302140 |
taaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaa |
17302085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 26238816 - 26238871
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
26238871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 29865224 - 29865279
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
29865224 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29865279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 31326249 - 31326194
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
31326249 |
taaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgtaa |
31326194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 32476098 - 32476153
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
32476098 |
taaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctgtaa |
32476153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 36622253 - 36622308
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
36622253 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
36622308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 36815832 - 36815785
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||| |
|
|
| T |
36815832 |
taaaatatggttttggtccatgcaaatatgtctcgttttggttttagt |
36815785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 1075 - 1118
Target Start/End: Original strand, 37228820 - 37228863
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37228820 |
ttttggttttggtccctgaccccacttttgtgatgatttgcaca |
37228863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 37910759 - 37910814
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
37910759 |
taaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgtaa |
37910814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 37911117 - 37911062
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||| ||| ||||| |
|
|
| T |
37911117 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgtaa |
37911062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 38731832 - 38731887
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
38731832 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38731887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 40124969 - 40125016
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
40124969 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
40125016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 40302336 - 40302281
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
40302336 |
taaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgtaa |
40302281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 41694000 - 41693945
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
41694000 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
41693945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1116
Target Start/End: Original strand, 41791021 - 41791156
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaannnnnnnnattatttttggtctctgcaa----ttttggttttga |
1086 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| ||||| ||||||||| ||||| ||| |||||||||||||||| ||||| |||||| |
|
|
| T |
41791021 |
taaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaaaaaaaaaaattgtttttggtctctgcaaaattttttgtttttga |
41791120 |
T |
 |
| Q |
1087 |
------tccctgacgccacttttgtgatgatttgca |
1116 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
41791121 |
aaatagtccctgaccccacttttgtgatgatttgca |
41791156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 43597157 - 43597212
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
43597157 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaa |
43597212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 43710705 - 43710650
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| | ||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
43710705 |
taaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgtaa |
43710650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 1073 - 1119
Target Start/End: Complemental strand, 31909383 - 31909337
Alignment:
| Q |
1073 |
aattttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
31909383 |
aattttggttttggtccctggccccacttttgtgatgatttgcacac |
31909337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 4042793 - 4042748
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
4042793 |
attttggttttggtccctgacttcacttttgtgatgatttgcacac |
4042748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 4423992 - 4424037
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
4423992 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
4424037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 4794133 - 4794182
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
4794133 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtcc |
4794182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 5790561 - 5790610
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||| || |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
5790561 |
taaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtcc |
5790610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 5790896 - 5790847
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
5790896 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
5790847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 16673414 - 16673463
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||| ||||||||| |
|
|
| T |
16673414 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
16673463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 17541385 - 17541434
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
17541385 |
taaaatatggttttagtccccgcaaatatgcctcgttttggttttagtcc |
17541434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 19183785 - 19183834
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
19183785 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19183834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 20939228 - 20939183
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
20939228 |
attttggttttggtccctgaccccacttttgtgatgatttacacac |
20939183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 26239157 - 26239108
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
26239157 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
26239108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 26813869 - 26813918
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
26813869 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26813918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 33575755 - 33575804
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
33575755 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtcc |
33575804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 33733238 - 33733193
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
33733238 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33733193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 994 - 1043
Target Start/End: Original strand, 35155298 - 35155347
Alignment:
| Q |
994 |
aatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
||||||||||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
35155347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 40125063 - 40125108
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
40125063 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
40125108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 1138080 - 1138124
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
1138080 |
ttttggttttggtccccgaccccacttttgtgatgatttgcacac |
1138124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 3832634 - 3832586
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 13850881 - 13850833
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||| | ||||||||||| |||||||| |||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtc |
13850833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 16523087 - 16523131
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||| ||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
16523087 |
tttaggttttggtccctggcgccacttttgtgatgatttgcacac |
16523131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1043
Target Start/End: Complemental strand, 17541773 - 17541721
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
17541773 |
taaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttg |
17541721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 17912808 - 17912760
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||| |||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
17912760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 23989841 - 23989889
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
23989841 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 29182266 - 29182310
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
29182266 |
ttttggttttcgtccctgactccacttttgtgatgatttgcacac |
29182310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 31909475 - 31909428
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
31909475 |
taaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtc |
31909428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 37228736 - 37228784
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |||||||| |
|
|
| T |
37228736 |
taaaatatggttttggtccctgcaaatatgtatcgttttggttttagtc |
37228784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 38639415 - 38639463
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| |||||||| |
|
|
| T |
38639415 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
38639463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 1138356 - 1138301
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
1138356 |
taaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgtaa |
1138301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 9195057 - 9195104
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||| |
|
|
| T |
9195057 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
9195104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 10375066 - 10375011
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||| ||| ||||| |
|
|
| T |
10375066 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgtaa |
10375011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 10664987 - 10665042
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| | ||||||| ||||| |
|
|
| T |
10664987 |
taaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgtaa |
10665042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 12835328 - 12835383
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
12835328 |
taaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
12835383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 14392791 - 14392846
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| ||| |||||||||||||||| ||||| ||||||||| |
|
|
| T |
14392791 |
taaaatatggttttagtcattgtaaatatgcctcgttttagttttaatccttgtaa |
14392846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 16968555 - 16968610
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| | ||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgtaa |
16968610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 18113451 - 18113396
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||||| ||||| ||| ||||| |
|
|
| T |
18113451 |
taaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgtaa |
18113396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 20658064 - 20658119
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||| |||||||| |||| ||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
20658064 |
taaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaa |
20658119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1030
Target Start/End: Complemental strand, 23732325 - 23732286
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
1030 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23732325 |
taaaatatggttttggtctctgcaaatatgcctcgttttg |
23732286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 25954118 - 25954173
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
25954118 |
taaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtccttgtaa |
25954173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1030
Target Start/End: Original strand, 27310879 - 27310918
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
1030 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
27310879 |
taaaatatggttttagtccctgcaaatatgcctcgttttg |
27310918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 30215868 - 30215813
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||| | ||||||| ||||||||| ||||| |
|
|
| T |
30215868 |
taaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgtaa |
30215813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 31225718 - 31225765
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
31225718 |
taaaatatagttttagtccctgcaaatatgcctcgttttgattttagt |
31225765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 31226074 - 31226019
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
31226074 |
taaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgtaa |
31226019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 34964156 - 34964101
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |||||| || ||||| |
|
|
| T |
34964156 |
taaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctgtaa |
34964101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 36622581 - 36622534
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||| |
|
|
| T |
36622581 |
taaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 40125286 - 40125231
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
40125286 |
taaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgtaa |
40125231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 40301978 - 40302033
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
40301978 |
taaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaa |
40302033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 41693677 - 41693732
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
41693677 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
41693732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 44985981 - 44985926
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
44985981 |
taaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaa |
44985926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 993 - 1039
Target Start/End: Complemental strand, 4794468 - 4794422
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||| | |||||||| ||||||||| |||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
4794422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 1077 - 1119
Target Start/End: Original strand, 27109142 - 27109184
Alignment:
| Q |
1077 |
ttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
27109142 |
ttggttttggtccctggctccacttttgtgatgatttgcacac |
27109184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1045
Target Start/End: Complemental strand, 35155616 - 35155562
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgta |
1045 |
Q |
| |
|
||||||||||||||||||| || ||||||| || |||||| ||||||||| |||| |
|
|
| T |
35155616 |
taaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgta |
35155562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 146423 - 146468
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
146423 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
146468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 2481290 - 2481335
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
2481290 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
2481335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 3832368 - 3832413
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| || ||| | |||||||||||||||||||||||| |
|
|
| T |
3832368 |
attttggttttggtctctggccccacttttgtgatgatttgcacac |
3832413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 4842867 - 4842916
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||||| | |||||||||| ||||||||| ||||||||| |
|
|
| T |
4842867 |
taaaatatggttttggatcctgcaaatatgtctcgttttggttttagtcc |
4842916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 7814249 - 7814298
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||| ||||| |||| || ||||||||||||||||| ||||||||| |
|
|
| T |
7814249 |
taaaatattgttttagtccctgtaaatatgcctcgttttggttttagtcc |
7814298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 7814734 - 7814685
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
7814734 |
taaaatatgattttagtccctgcaaatatgcctcattttggttttagtcc |
7814685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 10671727 - 10671772
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||| ||||||||||||||| |
|
|
| T |
10671727 |
attttggttttggtccctggctccacttttctgatgatttgcacac |
10671772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 16673508 - 16673553
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
16673508 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
16673553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 24358848 - 24358803
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
24358848 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
24358803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 33576049 - 33576004
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
33576049 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
33576004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 34317895 - 34317940
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| || ||| | |||||||||||||||||||||||| |
|
|
| T |
34317895 |
attttggttttggtctctggccccacttttgtgatgatttgcacac |
34317940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 989 - 1038
Target Start/End: Complemental strand, 35686337 - 35686288
Alignment:
| Q |
989 |
gataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||| ||| || |||||||| |||||||| ||||||| |
|
|
| T |
35686337 |
gataaaatatggttttgatccctgtaaatatgcttcgttttggttttagt |
35686288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 41451934 - 41451979
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
41451934 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
41451979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 42695965 - 42696010
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| ||| || | |||||||||||||||||||||||| |
|
|
| T |
42695965 |
attttggttttggtccttggccccacttttgtgatgatttgcacac |
42696010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 43789189 - 43789140
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| || | ||||||||||| |||||||| ||||||||| |
|
|
| T |
43789189 |
taaaatatggttttagttcctgcaaatatgcttcgttttggttttagtcc |
43789140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 2e-18; HSPs: 170)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 986 - 1046
Target Start/End: Original strand, 6146514 - 6146574
Alignment:
| Q |
986 |
aaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6146514 |
aaagctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaa |
6146574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 7326089 - 7326138
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7326089 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttttagtcc |
7326138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 7326418 - 7326363
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
7326418 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
7326363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 11976376 - 11976431
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
11976376 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
11976431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 20278054 - 20277999
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
20278054 |
taaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaa |
20277999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 21064681 - 21064626
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
21064681 |
taaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaa |
21064626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 32418321 - 32418376
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32418321 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
32418376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 2728594 - 2728545
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
2728594 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2728545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 4017297 - 4017248
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4017297 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
4017248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 4710217 - 4710168
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
4710217 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
4710168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 8094838 - 8094789
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8094838 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
8094789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 11019854 - 11019805
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
11019854 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
11019805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 28346397 - 28346446
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
28346397 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
28346446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 28346755 - 28346706
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
28346755 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
28346706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 32726268 - 32726219
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
32726268 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
32726219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 34963303 - 34963352
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
34963303 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
34963352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 35097689 - 35097640
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35097689 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
35097640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 37536089 - 37536138
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
37536089 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
37536138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 991 - 1043
Target Start/End: Original strand, 1685117 - 1685169
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
1685169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 24090485 - 24090437
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
24090485 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24090437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 990 - 1046
Target Start/End: Complemental strand, 28497617 - 28497561
Alignment:
| Q |
990 |
ataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
28497617 |
ataaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28497561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 4474041 - 4473986
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
4474041 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaa |
4473986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 4621351 - 4621296
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
4621351 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4621296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 7186001 - 7185946
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
7186001 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
7185946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 7420587 - 7420532
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
7420587 |
taaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgtaa |
7420532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 8298590 - 8298645
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
8298590 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
8298645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 8298972 - 8298917
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
8298972 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
8298917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 9175015 - 9175070
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
9175015 |
taaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgtaa |
9175070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 10337122 - 10337177
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
10337122 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
10337177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 10540779 - 10540724
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
10540779 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaa |
10540724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 10872918 - 10872973
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
10872918 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaa |
10872973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 13154889 - 13154944
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
13154889 |
taaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgtaa |
13154944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 13232201 - 13232256
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13232256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 14489070 - 14489015
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
14489070 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
14489015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 16789366 - 16789311
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
16789366 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16789311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 20277695 - 20277750
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
20277695 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaa |
20277750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 20984149 - 20984204
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
20984149 |
taaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaa |
20984204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 21064322 - 21064377
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
21064322 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaa |
21064377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 27341588 - 27341533
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
27341588 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
27341533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1119
Target Start/End: Original strand, 28497258 - 28497396
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaannnnnnnnattatttttggtctctgcaa----------ttttgg |
1080 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| ||||||||| ||||| || ||||||||| |||||| |||||| |
|
|
| T |
28497258 |
taaaatatgattttggtccctgcaaatatgcctcgttttagttttagtccatgtaattttttttgttgtttttggtccctgcaaatatgaatcgttttgg |
28497357 |
T |
 |
| Q |
1081 |
ttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
28497358 |
ttttggtccctgaccccacttttgtgatgatttgcacac |
28497396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 42133151 - 42133096
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
42133151 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
42133096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 42430117 - 42430062
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
42430117 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgtaa |
42430062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 43477166 - 43477221
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
43477166 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
43477221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 1778567 - 1778616
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
1778567 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
1778616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 3511909 - 3511958
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
3511909 |
taaaatatggttttggtcccttcaaatatgcctcgttttggttttagtcc |
3511958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 3512263 - 3512214
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
3512263 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3512214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 5357426 - 5357475
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
5357426 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
5357475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 985 - 1046
Target Start/End: Complemental strand, 6146952 - 6146891
Alignment:
| Q |
985 |
aaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
6146952 |
aaaagctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
6146891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 7420233 - 7420282
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
7420233 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
7420282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 8298684 - 8298729
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
8298684 |
attttggttttggtccctgactccacttttgtgatgatttgcacac |
8298729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 9496720 - 9496671
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
9496720 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
9496671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 10337446 - 10337397
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
10337446 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagtcc |
10337397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 10873277 - 10873228
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
10873277 |
taaaatatggttttggtctctgcaaatatgcctcgttttggttttagtcc |
10873228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 11019523 - 11019572
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
11019523 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
11019572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 11976733 - 11976684
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
11976684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 14239077 - 14239028
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
14239077 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
14239028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 19494410 - 19494361
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
19494410 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
19494361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 22917567 - 22917616
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
22917567 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22917616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 993 - 1042
Target Start/End: Original strand, 24814710 - 24814759
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcctt |
1042 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcctt |
24814759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 993 - 1046
Target Start/End: Complemental strand, 29992295 - 29992242
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
29992295 |
aaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctgtaa |
29992242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 32725910 - 32725959
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
32725910 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
32725959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 34963661 - 34963612
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
34963661 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
34963612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 35097331 - 35097380
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
35097331 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35097380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 35346632 - 35346681
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
35346632 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35346681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 35346995 - 35346946
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
35346995 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35346946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 37536416 - 37536367
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
37536416 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
37536367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 1525812 - 1525860
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
1525812 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1525860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 9175368 - 9175320
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| |||||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
9175320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 4375695 - 4375750
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
4375695 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaa |
4375750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 5357760 - 5357705
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
5357760 |
taaaatatgattttggtccctgcaaatatgcttcgttttggttttagtctttgtaa |
5357705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 7272748 - 7272693
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
7272748 |
taaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgtaa |
7272693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 9496344 - 9496391
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||| |
|
|
| T |
9496344 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
9496391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 10776151 - 10776206
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
10776151 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaa |
10776206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 10776496 - 10776449
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
10776496 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10776449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 13232559 - 13232512
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
13232559 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 13779529 - 13779474
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||| |||||| || ||||| |
|
|
| T |
13779529 |
taaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctgtaa |
13779474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 14495072 - 14495119
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
14495072 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
14495119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 17073810 - 17073865
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
17073810 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
17073865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 17574460 - 17574405
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
17574460 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
17574405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 18549570 - 18549515
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
18549570 |
taaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgtaa |
18549515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 20984507 - 20984452
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| | |||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
20984507 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
20984452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 22650467 - 22650522
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
22650467 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
22650522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 25600233 - 25600280
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||| |
|
|
| T |
25600233 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
25600280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 25702515 - 25702570
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||| ||||||||| ||||| |
|
|
| T |
25702515 |
taaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgtaa |
25702570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 27117756 - 27117811
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
27117756 |
taaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgtaa |
27117811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 29158357 - 29158412
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
29158357 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
29158412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 29488107 - 29488052
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
29488107 |
taaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
29488052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 30969401 - 30969456
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||| ||||||||| ||||| |
|
|
| T |
30969401 |
taaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgtaa |
30969456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 40066817 - 40066762
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
40066817 |
taaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgtaa |
40066762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 40844159 - 40844214
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
40844159 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
40844214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 43727430 - 43727376
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
43727430 |
taaaatatggttttagtcct-gcaaatatgtctcgttttggttttagtccttgtaa |
43727376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1036
Target Start/End: Original strand, 4016903 - 4016953
Alignment:
| Q |
986 |
aaagataaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
4016903 |
aaagctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4016953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 1162912 - 1162961
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
1162912 |
taaaatatggttttagtccctgcaaatatgcttcgttttgattttagtcc |
1162961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 1526169 - 1526120
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
1526169 |
taaaatatggttttagtccctgcaaatatggctcgttttggttttagtcc |
1526120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 1778661 - 1778706
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
1778661 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
1778706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 2728500 - 2728455
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||| |
|
|
| T |
2728500 |
attttggttttggtccctgactccacttttgtgataatttgcacac |
2728455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 993 - 1046
Target Start/End: Original strand, 3680532 - 3680585
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||| ||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgtaa |
3680585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 4473707 - 4473756
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||| | ||||||||| ||||||||| |
|
|
| T |
4473707 |
taaaatatggttttggtccctgcaaatacgtctcgttttggttttagtcc |
4473756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 4473801 - 4473846
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
4473801 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
4473846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 5357666 - 5357621
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||| |||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
5357666 |
attttagttttggtccctgactccacttttgtgatgatttgcacac |
5357621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 7326183 - 7326228
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
7326183 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
7326228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 7420327 - 7420372
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
7420327 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
7420372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 10540452 - 10540501
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
10540452 |
taaaatattgttttggtctctgcaaatatgcctcgttttggttttagtcc |
10540501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 10540546 - 10540591
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
10540546 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
10540591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 10755525 - 10755480
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
10755525 |
taaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10755480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 13232295 - 13232340
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
13232295 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
13232340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 14238754 - 14238803
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
14238754 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
14238803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 16643664 - 16643713
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
16643664 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
16643713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 16644041 - 16643992
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
16644041 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtcc |
16643992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 24814802 - 24814847
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
24814802 |
attttggttttggtccctgaccccacttttgttatgatttgcacac |
24814847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 24955007 - 24954958
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
24955007 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtcc |
24954958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 25131444 - 25131395
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||| ||||||||| |
|
|
| T |
25131444 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtcc |
25131395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 25600328 - 25600373
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
25600328 |
attttggttttggtccctgtctccacttttgtgatgatttgcacac |
25600373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 27117973 - 27117924
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| |||| |||| |
|
|
| T |
27117973 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttggtcc |
27117924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 29992204 - 29992159
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
29992204 |
attttggttttggtccctgaccccacttttgtgatgatttacacac |
29992159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 32726174 - 32726129
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
32726174 |
attttggttttgatccctggctccacttttgtgataatttgcacac |
32726129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 33526409 - 33526360
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
33526409 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
33526360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 33636325 - 33636374
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
33636325 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
33636374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1075 - 1116
Target Start/End: Complemental strand, 35115601 - 35115560
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgca |
1116 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
35115601 |
ttttggttttggtccctgaccccacttttgtgatgatttgca |
35115560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1036
Target Start/End: Original strand, 42132867 - 42132912
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
42132867 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42132912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 42132961 - 42133006
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
42132961 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
42133006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1036
Target Start/End: Original strand, 44997934 - 44997979
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
44997934 |
taaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
44997979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1074 - 1114
Target Start/End: Original strand, 2811538 - 2811578
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttg |
1114 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
2811538 |
attttggttttgatccatgaccccacttttgtgatgatttg |
2811578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| |||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 7272423 - 7272471
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| |||||||| |
|
|
| T |
7272423 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
7272471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 18549204 - 18549252
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| |||||||| |
|
|
| T |
18549204 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
18549252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 29991918 - 29991966
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtc |
29991966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 984 - 1036
Target Start/End: Complemental strand, 36044796 - 36044744
Alignment:
| Q |
984 |
taaaagataaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||| || ||||||||| ||||| |
|
|
| T |
36044796 |
taaaagctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 6469283 - 6469330
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||| ||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
6469283 |
taaaatatggctttcgtccctgcaaatatgcctcgttttggttttagt |
6469330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 13779152 - 13779207
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||| ||| ||||| |
|
|
| T |
13779152 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgtaa |
13779207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 1075 - 1118
Target Start/End: Complemental strand, 13779437 - 13779394
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
13779437 |
ttttggttttggtccatgaccccacttttgtgatgatttgcaca |
13779394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 16789078 - 16789125
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||| |
|
|
| T |
16789078 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
16789125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 19494122 - 19494169
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||| |
|
|
| T |
19494122 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19494169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 19962998 - 19963053
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||| || ||||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
19962998 |
taaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgtaa |
19963053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 1075 - 1118
Target Start/End: Original strand, 23939645 - 23939688
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
23939645 |
ttttggttttagtccctgaccccacttttgtgatgatttgcaca |
23939688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 24187572 - 24187627
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
24187572 |
taaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgtaa |
24187627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 24815065 - 24815010
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
24815065 |
taaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgtaa |
24815010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 25131114 - 25131161
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||| |
|
|
| T |
25131114 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
25131161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 28324178 - 28324123
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| | |||||||| || |||||| ||||||||| ||||| |
|
|
| T |
28324178 |
taaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgtaa |
28324123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 29158666 - 29158611
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
29158666 |
taaaatatggttttaatccctgcaaatatatctcgttttggttttagtccttgtaa |
29158611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 35345614 - 35345559
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
35345614 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgtaa |
35345559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 1075 - 1118
Target Start/End: Complemental strand, 36044693 - 36044650
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
36044693 |
ttttggttttggtccctgacctcacttttgtgatgatttgcaca |
36044650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 40066500 - 40066547
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||| |
|
|
| T |
40066500 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttagt |
40066547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 40492963 - 40493018
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| || | |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
40492963 |
taaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgtaa |
40493018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 40844532 - 40844477
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgtaa |
40844477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 14495387 - 14495338
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
14495387 |
taaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtcc |
14495338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1045
Target Start/End: Original strand, 21125722 - 21125776
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgta |
1045 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||||||| ||||| ||| |||| |
|
|
| T |
21125722 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
21125776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 1408350 - 1408301
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||| ||||||||| |
|
|
| T |
1408350 |
taaaatatggttttagtccctgcaaatatgcctcattttagttttagtcc |
1408301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 3512169 - 3512124
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
3512169 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
3512124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 3680798 - 3680749
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||||||||||| |||| |||| |
|
|
| T |
3680798 |
taaaatatgattttgatccctgcaaatatgcctcgttttggttttggtcc |
3680749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 4710003 - 4710048
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
4710003 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
4710048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 8094482 - 8094531
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
8094482 |
taaaatatggttttagtctctgcaaatatgtctcgttttggttttagtcc |
8094531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 9496626 - 9496581
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
9496626 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
9496581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 10873184 - 10873139
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||| |||||||||||||||||||| |
|
|
| T |
10873184 |
attttggttttggtccctggctccaattttgtgatgatttgcacac |
10873139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 11019617 - 11019662
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
11019617 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
11019662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 11976639 - 11976594
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
11976639 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
11976594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 14496819 - 14496868
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| || | ||||||||||| |||||||| ||||||||| |
|
|
| T |
14496819 |
taaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtcc |
14496868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 14847828 - 14847877
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
14847828 |
taaaatatgattttgatccctgcaaatatgcctcattttggttttagtcc |
14847877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 15719659 - 15719708
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||||||||| ||||||||| |
|
|
| T |
15719659 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtcc |
15719708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 20984243 - 20984288
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||| |||||||||| |
|
|
| T |
20984243 |
attttggttttggtccctgactcgacttttgtgataatttgcacac |
20984288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 24090122 - 24090171
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||| |||| | ||||| ||||||||| ||||||||| |
|
|
| T |
24090122 |
taaaatatggttttggttcttgtagatatgtctcgttttgattttagtcc |
24090171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 28323852 - 28323901
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||| | |||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
28323852 |
taaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtcc |
28323901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1024
Target Start/End: Complemental strand, 30969714 - 30969681
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctc |
1024 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
30969714 |
taaaatatggttttggtccctgcaaatatgcctc |
30969681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 33526055 - 33526104
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| ||| |||| ||||||||| |
|
|
| T |
33526055 |
taaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 34963397 - 34963442
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
34963397 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
34963442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 35097595 - 35097550
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
35097595 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
35097550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 35143841 - 35143792
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| || ||||||||||||||||| ||||||||| |
|
|
| T |
35143841 |
taaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtcc |
35143792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 37536322 - 37536277
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
37536322 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
37536277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 38930661 - 38930616
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
38930661 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
38930616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 44998167 - 44998123
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
44998167 |
attttggttttggtccctg-ctccacttttgtgatgatttgcacac |
44998123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 2e-18; HSPs: 197)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 986 - 1046
Target Start/End: Complemental strand, 25610132 - 25610072
Alignment:
| Q |
986 |
aaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25610132 |
aaagctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccttgtaa |
25610072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 3830513 - 3830458
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3830513 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
3830458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 8555305 - 8555250
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccttgtaa |
8555250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 19656544 - 19656599
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19656544 |
taaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccttgtaa |
19656599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 25615978 - 25616033
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
25615978 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25616033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 28452150 - 28452205
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
28452150 |
taaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgtaa |
28452205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 30034110 - 30034165
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||| |
|
|
| T |
30034110 |
taaaatatggttttggtccttgtaaatatgcctcgttttggttttaatccttgtaa |
30034165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 31480139 - 31480194
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
31480139 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
31480194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 47005516 - 47005461
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
47005516 |
taaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttgtaa |
47005461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 49323785 - 49323840
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
49323785 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
49323840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 982 - 1040
Target Start/End: Complemental strand, 8940531 - 8940473
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||| | ||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
8940531 |
tttaaaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
8940473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 9262152 - 9262103
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
9262152 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
9262103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 985 - 1046
Target Start/End: Original strand, 11463229 - 11463290
Alignment:
| Q |
985 |
aaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||| ||||||||||||||||| | |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
11463229 |
aaaagctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgtaa |
11463290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 22008887 - 22008838
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
22008887 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
22008838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 28552380 - 28552331
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
28552380 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
28552331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 40370586 - 40370537
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
40370586 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
40370537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 982 - 1039
Target Start/End: Complemental strand, 46186777 - 46186720
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||| | |||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
46186777 |
tttaaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
46186720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 51550085 - 51550134
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
51550085 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
51550134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 54608521 - 54608570
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
54608521 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
54608570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 1721092 - 1721147
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgtaa |
1721147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 1721449 - 1721394
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
1721449 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaa |
1721394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 2486899 - 2486844
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
2486899 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccttgtaa |
2486844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 3387601 - 3387546
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
3387601 |
taaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccatgtaa |
3387546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 4034720 - 4034775
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
4034720 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
4034775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 4513266 - 4513321
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
4513266 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4513321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 4950040 - 4950095
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
4950040 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4950095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1119
Target Start/End: Complemental strand, 7957223 - 7957085
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaannnnnnnnattatttttggtctctgcaa----------ttttgg |
1080 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| |||||||| ||||||||| ||||| || ||||||||| |||||| |||||| |
|
|
| T |
7957223 |
taaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgtaattttttttgttgtttttggtccctgcaaatatgtctcgttttgg |
7957124 |
T |
 |
| Q |
1081 |
ttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
7957123 |
ttttggtccctgaccccacttttgtgatgatttgcacac |
7957085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 9261792 - 9261847
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
9261792 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
9261847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 12741268 - 12741213
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
12741268 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
12741213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 19844578 - 19844523
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
19844578 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
19844523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 21159456 - 21159511
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
21159456 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
21159511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 25710867 - 25710812
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
25710867 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25710812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 26090075 - 26090020
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
26090075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
26090020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 28552024 - 28552079
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
28552024 |
taaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgtaa |
28552079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 29678027 - 29678082
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
29678027 |
taaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgtaa |
29678082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 29955301 - 29955356
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
29955301 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
29955356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 30004455 - 30004510
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
30004455 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
30004510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 30034469 - 30034414
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
30034469 |
taaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgtaa |
30034414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 30106217 - 30106162
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
30106217 |
taaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgtaa |
30106162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 35569133 - 35569078
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35569078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 38232244 - 38232299
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| ||||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
38232244 |
taaaatatgattttggtccctgcaaatatgtctcgttttgattttagtccttgtaa |
38232299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 45002024 - 45002071
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
45002024 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
45002071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 45002382 - 45002327
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
45002382 |
taaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaa |
45002327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 45313860 - 45313805
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
45313860 |
taaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgtaa |
45313805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 46186412 - 46186467
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46186412 |
taaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccttgtaa |
46186467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 46751274 - 46751329
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46751274 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgtaa |
46751329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 47336578 - 47336523
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
47336578 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
47336523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 48924237 - 48924182
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| ||||||||| ||||| |
|
|
| T |
48924237 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaa |
48924182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 50009281 - 50009226
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
50009281 |
taaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctgtaa |
50009226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 50196302 - 50196357
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
50196302 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
50196357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 51550443 - 51550388
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
51550443 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
51550388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 54608860 - 54608805
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
54608860 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
54608805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 474047 - 474096
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
474047 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
474096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 3151753 - 3151802
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3151753 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3151802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 3152108 - 3152059
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3152108 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3152059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 4034814 - 4034859
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
4034814 |
attttggttttggtccctgactccacttttgtgatgatttgcacac |
4034859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 9262057 - 9262012
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
9262057 |
attttggttttggtccctgactccacttttgtgatgatttgcacac |
9262012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 9603632 - 9603681
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
9603632 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
9603681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 9603726 - 9603771
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
9603726 |
attttggttttggtccctgactccacttttgtgatgatttgcacac |
9603771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 10976981 - 10977030
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
10976981 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
10977030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 12740910 - 12740959
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
12740910 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
12740959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 14772214 - 14772263
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
14772214 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
14772263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 15979341 - 15979390
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
15979341 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
15979390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 20612895 - 20612846
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
20612895 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
20612846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 22156290 - 22156241
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
22156290 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22156241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 26089733 - 26089782
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
26089733 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
26089782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 28427605 - 28427556
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
28427605 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
28427556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 31480497 - 31480448
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
31480497 |
taaaatatggatttggtccctgcaaatatgcctcgttttggttttagtcc |
31480448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 32119581 - 32119532
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
32119581 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
32119532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 37506870 - 37506919
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
37506870 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
37506919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 37507219 - 37507170
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
37507219 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
37507170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 39437106 - 39437057
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
39437106 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
39437057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 43441600 - 43441551
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
43441600 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
43441551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 46622126 - 46622077
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
46622126 |
taaaatatggttttggtccttgcaaatatgtttcgttttggttttagtcc |
46622077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 47336231 - 47336280
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
47336231 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
47336280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 51834611 - 51834660
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
51834611 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
51834660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 52342485 - 52342440
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
52342485 |
attttggttttggtccctgactccacttttgtgatgatttgcacac |
52342440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 8555210 - 8555166
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
8555210 |
ttttggttttggtccctgaccccacttttgtgatgatttgcacac |
8555166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 29490740 - 29490692
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
29490740 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
29490692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1043
Target Start/End: Original strand, 34238601 - 34238653
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
34238601 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
34238653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 474405 - 474358
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||| |
|
|
| T |
474405 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
474358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 863649 - 863594
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgtaa |
863594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 3830137 - 3830192
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
3830137 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
3830192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 4035050 - 4035003
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
4035050 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagt |
4035003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 5345686 - 5345631
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
5345686 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
5345631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 7518093 - 7518148
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7518093 |
taaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtccttgtaa |
7518148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 9597092 - 9597037
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
9597092 |
taaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgtaa |
9597037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 9863401 - 9863346
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
9863401 |
taaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
9863346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 15979698 - 15979643
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| | |||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
15979698 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
15979643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 16679679 - 16679734
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| |||||||| |||||||| |||||| |
|
|
| T |
16679679 |
taaaatatggttttagtccttgaaaatatgcttcgttttggttttagtctttgtaa |
16679734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 19844268 - 19844323
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||| ||||||||| ||||| |
|
|
| T |
19844268 |
taaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgtaa |
19844323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 21159814 - 21159767
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
21159814 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
21159767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 21553892 - 21553947
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||| || ||||| |
|
|
| T |
21553892 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctgtaa |
21553947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 22008529 - 22008584
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
22008529 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
22008584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 22016047 - 22016102
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
22016047 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
22016102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 25609770 - 25609825
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||| || |||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
25609770 |
taaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgtaa |
25609825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 29445957 - 29446012
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
29445957 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29446012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 29446203 - 29446148
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| || |||||| ||||||||||||||| |
|
|
| T |
29446203 |
taaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgtaa |
29446148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 30268508 - 30268563
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
30268508 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30268563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 35565511 - 35565566
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| ||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
35565511 |
taaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgtaa |
35565566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 40545567 - 40545622
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
40545567 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgtaa |
40545622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 43441273 - 43441320
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||| |
|
|
| T |
43441273 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
43441320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 45320976 - 45320921
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
45320976 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45320921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 47005157 - 47005212
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
47005157 |
taaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgtaa |
47005212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 989 - 1040
Target Start/End: Complemental strand, 49324145 - 49324094
Alignment:
| Q |
989 |
gataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||||||||| ||||||||| |
|
|
| T |
49324145 |
gataaaatatggttttggtccctgtaaatatgtctcgttttggttttagtcc |
49324094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 52342580 - 52342525
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
52342580 |
taaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtccatgtaa |
52342525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 53701660 - 53701605
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
53701660 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
53701605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 991 - 1037
Target Start/End: Original strand, 14633548 - 14633594
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttag |
1037 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||| |
|
|
| T |
14633548 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
14633594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 991 - 1045
Target Start/End: Original strand, 16123142 - 16123196
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgta |
1045 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||||||| ||||||||| |||| |
|
|
| T |
16123142 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgta |
16123196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 982 - 1040
Target Start/End: Original strand, 39436712 - 39436770
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||| | |||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
39436712 |
tttaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
39436770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 275447 - 275496
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
275447 |
taaaatatggttttagtccctgcaactatgcctcgttttgattttagtcc |
275496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 986 - 1039
Target Start/End: Complemental strand, 3361820 - 3361767
Alignment:
| Q |
986 |
aaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||||||||| |||||| |||||||| |
|
|
| T |
3361820 |
aaagctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
3361767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 3387268 - 3387317
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtcc |
3387317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 3387362 - 3387407
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
3387362 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
3387407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 8510217 - 8510266
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
8510217 |
taaaatatggttttagtccctgcaaatatgcctctttttggttttagtcc |
8510266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 9603916 - 9603871
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
9603916 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 13584364 - 13584315
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
13584364 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
13584315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 15016391 - 15016440
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
15016391 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
15016440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 20757403 - 20757452
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
20757452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 22155932 - 22155981
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
22155932 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
22155981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 993 - 1046
Target Start/End: Original strand, 25710515 - 25710568
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
25710515 |
aaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
25710568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 26799891 - 26799940
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||||||| ||||||||| |
|
|
| T |
26799891 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
26799940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 985 - 1046
Target Start/End: Complemental strand, 28418903 - 28418842
Alignment:
| Q |
985 |
aaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||| | |||||| ||||||||| ||||| |
|
|
| T |
28418903 |
aaaagctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgtaa |
28418842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 28452373 - 28452324
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||||| ||||||||| |
|
|
| T |
28452373 |
taaaatatggttttggtccctacaaatatgcttcgttttggttttagtcc |
28452324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 28942902 - 28942853
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||| ||||||||| |
|
|
| T |
28942902 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtcc |
28942853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 993 - 1038
Target Start/End: Complemental strand, 29955661 - 29955616
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
29955661 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
29955616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 993 - 1038
Target Start/End: Complemental strand, 30004816 - 30004771
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
30004816 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
30004771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 30426223 - 30426175
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
30426223 |
taaaatatggttttagtcct-gcaaatatgcctcgttttgattttagtcc |
30426175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 39288895 - 39288846
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
39288895 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
39288846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 40169651 - 40169602
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
40169651 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
40169602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 990 - 1039
Target Start/End: Original strand, 40723120 - 40723169
Alignment:
| Q |
990 |
ataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||| |||| |||||||| |
|
|
| T |
40723120 |
ataaaatatggttttagtccttgcaaatattcctcgatttggttttagtc |
40723169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 43440498 - 43440547
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
43440498 |
taaaatatggttttagtccttgcaaatatgtctcgttttagttttagtcc |
43440547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 45005889 - 45005938
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtcc |
45005938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 45005983 - 45006028
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
45005983 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
45006028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 51500682 - 51500633
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
51500682 |
taaaatatggttctagtccctgcaaatatgcctcgttttggttttagtcc |
51500633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 51550179 - 51550224
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
51550179 |
attttggttttgatccctggctccacttttgtgataatttgcacac |
51550224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 51834939 - 51834890
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
51834939 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
51834890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1036
Target Start/End: Original strand, 52342198 - 52342243
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
52342198 |
taaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 7588321 - 7588369
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| |||||| |||||||| |
|
|
| T |
7588321 |
taaaatatagttttggtccctgcaaatatgccttgttttggttttagtc |
7588369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 19297946 - 19297898
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||| ||||||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
19297946 |
taaaatatagttttggtccttgtaaatatgtctcgttttgtttttagtc |
19297898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 20611023 - 20611071
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| |||||||| |
|
|
| T |
20611023 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
20611071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 994 - 1046
Target Start/End: Original strand, 29686550 - 29686602
Alignment:
| Q |
994 |
aatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||| |||||||||| || |||||| ||||||||| ||||| |
|
|
| T |
29686550 |
aatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgtaa |
29686602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1043
Target Start/End: Complemental strand, 34238912 - 34238860
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
34238912 |
taaaatatggttttagtccccgcaaatatgcttcgttttggttttagtccttg |
34238860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1074 - 1118
Target Start/End: Original strand, 36732735 - 36732779
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
|||||||||||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
36732735 |
attttggttttggttcctgaccccacttttgtgatgatttgcaca |
36732779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 38232510 - 38232466
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
38232510 |
ttttggttttgatccctgacctcacttttgtgatgatttgtacac |
38232466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 39132809 - 39132765
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
39132809 |
ttttggttttggtccctggccccacttttgtgatgatttgcacac |
39132765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 39288576 - 39288624
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| |||||||| |
|
|
| T |
39288576 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39288624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 40277920 - 40277964
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
40277920 |
ttttgattttggtccctgaccccacttttgtgatgatttgcacac |
40277964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 47114716 - 47114672
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
47114716 |
ttttggttttgatctctgacctcacttttgtgatgatttgcacac |
47114672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 50009018 - 50009062
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
50009018 |
ttttggttttggtccatgaccccacttttgtgatgatttgcacac |
50009062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1035
Target Start/End: Original strand, 53113446 - 53113490
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttt |
1035 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||| |
|
|
| T |
53113446 |
taaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 4513617 - 4513562
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
4513617 |
taaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgtaa |
4513562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 7518443 - 7518388
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| ||||||| ||||||| |
|
|
| T |
7518443 |
taaaatatggttttactccctgcaaatatgtctcgttttggttttagttcttgtaa |
7518388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 8940163 - 8940218
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| || ||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
8940163 |
taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgtaa |
8940218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 9596761 - 9596816
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
9596761 |
taaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgtaa |
9596816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 12673647 - 12673702
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| ||||| |||| || ||||||||||||||||| ||||||||| ||||| |
|
|
| T |
12673647 |
taaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgtaa |
12673702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 15286159 - 15286214
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
15286159 |
taaaatatggttttaatccctgcaaatatgcttcgttttggttttagtctttgtaa |
15286214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 1073 - 1116
Target Start/End: Complemental strand, 20405127 - 20405084
Alignment:
| Q |
1073 |
aattttggttttgatccctgacgccacttttgtgatgatttgca |
1116 |
Q |
| |
|
||||||||||||| || ||||| ||||||||||||||||||||| |
|
|
| T |
20405127 |
aattttggttttggtctctgactccacttttgtgatgatttgca |
20405084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 1075 - 1118
Target Start/End: Original strand, 20644603 - 20644646
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
||||||||||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
20644603 |
ttttggttttggtccctggccccacttttgtgatgatttgcaca |
20644646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 20644873 - 20644818
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| || |||||| || ||||||| ||||||||| ||||| |
|
|
| T |
20644873 |
taaaatatggttttggtccctgtaaatataccccgttttgattttagtccctgtaa |
20644818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 27681679 - 27681624
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
27681679 |
taaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgtaa |
27681624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 28942528 - 28942575
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| ||||||| |
|
|
| T |
28942528 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 30128287 - 30128334
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||| ||| ||||||||| ||||||| |
|
|
| T |
30128287 |
taaaatatggttttggtccctgcaaacatgtctcgttttggttttagt |
30128334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 30130161 - 30130208
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||| |
|
|
| T |
30130161 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
30130208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 31869953 - 31869898
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
31869953 |
taaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaa |
31869898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 35533282 - 35533337
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||| |||||||||| || |||||| |||||| |||||||| |
|
|
| T |
35533282 |
taaaatatggttttggtctctgcaaatatgtcttgttttggttttagaccttgtaa |
35533337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 1074 - 1113
Target Start/End: Original strand, 36673060 - 36673099
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgattt |
1113 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
36673060 |
attttggttttggtccctgaccccacttttgtgatgattt |
36673099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 39072210 - 39072155
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
39072210 |
taaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgtaa |
39072155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 40277825 - 40277880
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| |||||||| ||||| ||| ||||| |
|
|
| T |
40277825 |
taaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctgtaa |
40277880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 40279332 - 40279285
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
40279332 |
taaaatatggttttggtctttgcaaatatgtcttgttttgtttttagt |
40279285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 44802285 - 44802332
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||| |
|
|
| T |
44802285 |
taaaatatggttttagtccctgcaaatatgcgtcgttttggttttagt |
44802332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 45006246 - 45006191
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
45006246 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
45006191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 50196654 - 50196599
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| | ||||||||||||||||| ||||||||| ||||| |
|
|
| T |
50196654 |
taaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgtaa |
50196599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 54767524 - 54767469
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| | ||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctgtaa |
54767469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 982 - 1036
Target Start/End: Original strand, 7956863 - 7956917
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||| |||||||||||||||||| ||| |||||||| || ||||| ||||| |
|
|
| T |
7956863 |
tttaaaagctaaaatatggttttggtctttgtaaatatgcttcattttggtttta |
7956917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1041
Target Start/End: Original strand, 29525108 - 29525158
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcct |
1041 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||| |||||||||| |
|
|
| T |
29525108 |
taaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcct |
29525158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 989 - 1039
Target Start/End: Original strand, 36672964 - 36673014
Alignment:
| Q |
989 |
gataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||||||||| |||||||||| || |||||| |||||||| |
|
|
| T |
36672964 |
gataaaatatggttttggtctctgcaaatatgtcttgttttggttttagtc |
36673014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1037
Target Start/End: Complemental strand, 51760115 - 51760069
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttag |
1037 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||| |||||| |
|
|
| T |
51760115 |
taaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 474311 - 474266
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
474311 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
474266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 863555 - 863510
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||| | ||||||||||||| |
|
|
| T |
863555 |
attttggttttggtccctgaccccacttttattatgatttgcacac |
863510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1036
Target Start/End: Original strand, 4814543 - 4814588
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||| |
|
|
| T |
4814543 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 9863050 - 9863098
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtcc |
9863098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 10977338 - 10977289
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||| ||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
10977338 |
taaaatatggatttaatccctgcaaatatgcctcgttttggttttagtcc |
10977289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 12741004 - 12741049
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
12741004 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
12741049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 19844363 - 19844408
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
19844363 |
attttggttttggtccctggctgcacttttgtgatgatttgcacac |
19844408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 22008793 - 22008748
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
22008793 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
22008748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 22016311 - 22016266
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
22016311 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
22016266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 28418638 - 28418683
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| | |||| | |||||||||||||||||||||||| |
|
|
| T |
28418638 |
attttggttttggttcctggccccacttttgtgatgatttgcacac |
28418683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 28427248 - 28427297
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| || | |||||||||| ||||||||| ||||||||| |
|
|
| T |
28427248 |
taaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
28427297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 31480403 - 31480358
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
31480403 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
31480358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 32119487 - 32119442
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
32119487 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
32119442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 40169347 - 40169396
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
40169347 |
taaaatatggttttaatccctgcaaatatgtctcgttttgattttagtcc |
40169396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 43440784 - 43440735
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||| |||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
43440784 |
taaaatataattttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 45002118 - 45002163
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
45002118 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
45002163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 986 - 1039
Target Start/End: Original strand, 45161111 - 45161164
Alignment:
| Q |
986 |
aaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||| ||||||||||||| |||| |||||||||| ||||||||| |||||||| |
|
|
| T |
45161111 |
aaagttaaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtc |
45161164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 52956603 - 52956558
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||| ||||| |
|
|
| T |
52956603 |
attttggttttggtccctggctccacttttgtgatgatttacacac |
52956558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 54608615 - 54608660
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
54608615 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
54608660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 7e-18; HSPs: 165)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 30223792 - 30223737
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30223792 |
taaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgtaa |
30223737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 5e-16
Query Start/End: Original strand, 982 - 1046
Target Start/End: Complemental strand, 9659695 - 9659631
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||| | ||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
9659695 |
tttaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
9659631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 1614901 - 1614846
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
1614901 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
1614846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 3975552 - 3975607
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
3975552 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3975607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 10358365 - 10358310
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
10358365 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
10358310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 16853586 - 16853531
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
16853586 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16853531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 35837927 - 35837982
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
35837927 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
35837982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 39520727 - 39520672
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgtaa |
39520672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 45228915 - 45228860
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
45228915 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45228860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 46759661 - 46759716
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
46759661 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
46759716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 48852447 - 48852502
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48852447 |
taaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccttgtaa |
48852502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 991 - 1041
Target Start/End: Complemental strand, 3975835 - 3975785
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcct |
1041 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
3975835 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcct |
3975785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 985 - 1046
Target Start/End: Original strand, 6079806 - 6079867
Alignment:
| Q |
985 |
aaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||| |||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
6079806 |
aaaagctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
6079867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 8144655 - 8144606
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
8144655 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
8144606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 989 - 1046
Target Start/End: Complemental strand, 16941051 - 16940994
Alignment:
| Q |
989 |
gataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
16941051 |
gataaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
16940994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 23399615 - 23399664
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
23399615 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
23399664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 23676449 - 23676400
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
23676449 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
23676400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 25988746 - 25988697
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
25988746 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
25988697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 26878068 - 26878019
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
26878068 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
26878019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 29198659 - 29198610
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29198659 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
29198610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 993 - 1046
Target Start/End: Complemental strand, 35104290 - 35104237
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
35104290 |
aaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
35104237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 48192260 - 48192309
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
48192309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 48192485 - 48192436
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
48192485 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
48192436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 991 - 1043
Target Start/End: Original strand, 6589024 - 6589076
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
6589024 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccttg |
6589076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 5354771 - 5354826
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| ||||||||| ||||| |
|
|
| T |
5354771 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaa |
5354826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 5355114 - 5355059
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||| |||||||| |||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggttttagtcattgtaa |
5355059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 6589271 - 6589216
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtccatgtaa |
6589216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 12894399 - 12894344
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
12894399 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
12894344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 12932780 - 12932725
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
12932780 |
taaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
12932725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 13769777 - 13769832
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
13769777 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
13769832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 17999718 - 17999663
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
17999718 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
17999663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 18022701 - 18022646
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18022701 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
18022646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 19757751 - 19757806
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
19757751 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
19757806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 27458402 - 27458457
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
27458402 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
27458457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 28911903 - 28911848
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
28911903 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28911848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 31732448 - 31732393
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
31732448 |
taaaatatggttttagtccatgcaaatatgcctcgttttgattttagcccttgtaa |
31732393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 35838334 - 35838279
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
35838334 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35838279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 38186369 - 38186424
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||| || ||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctgtaa |
38186424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 41053845 - 41053900
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
41053845 |
taaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgtaa |
41053900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 41054233 - 41054178
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
41054233 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
41054178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 44841359 - 44841414
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgtaa |
44841414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 982 - 1040
Target Start/End: Original strand, 25092154 - 25092212
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||| | ||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
25092154 |
tttaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
25092212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 1006838 - 1006887
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
1006838 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1006887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 997 - 1046
Target Start/End: Complemental strand, 1271590 - 1271541
Alignment:
| Q |
997 |
atggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
1271541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 1614562 - 1614611
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
1614562 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
1614611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 5233811 - 5233860
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
5233811 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
5233860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 6108337 - 6108386
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
6108337 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
6108386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 8144298 - 8144347
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
8144298 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
8144347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 9659452 - 9659497
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
9659452 |
attttggttttggtccctgactccacttttgtgatgatttgcacac |
9659497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 11766920 - 11766969
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||| |||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtcc |
11766969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 23399973 - 23399924
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
23399973 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
23399924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 23676135 - 23676184
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
23676184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 25092545 - 25092496
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
25092545 |
taaaatatggttttggtccctgcaaatatgcctctttttggttttagtcc |
25092496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 25988388 - 25988437
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
25988388 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
25988437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 27037596 - 27037645
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
27037596 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagtcc |
27037645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 35015217 - 35015168
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35015217 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
35015168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 35838021 - 35838066
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
35838021 |
attttggttttggtccctgactccacttttgtgatgatttgcacac |
35838066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 44403246 - 44403197
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
44403246 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc |
44403197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 44508723 - 44508772
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
44508723 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
44508772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 44509051 - 44509002
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
44509051 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
44509002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1043
Target Start/End: Complemental strand, 1007226 - 1007174
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||| |||||||||||| |
|
|
| T |
1007226 |
taaaatatggttttagtccctccaaatatgcctcgttttgattttagtccttg |
1007174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 6847116 - 6847068
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
6847116 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
6847068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 1074 - 1118
Target Start/End: Original strand, 6891991 - 6892035
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
6891991 |
attttggttttggtccctgaccccacttttgtgatgatttgcaca |
6892035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 7431954 - 7432002
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
7431954 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 37159870 - 37159826
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
37159870 |
ttttggttttgttccctgacgcaacttttgtgatgatttgcacac |
37159826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 39438744 - 39438792
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| |||||||| |
|
|
| T |
39438744 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 1074 - 1118
Target Start/End: Complemental strand, 39438932 - 39438888
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
39438932 |
attttggttttggtccctgactccacttttgtgatgatttgcaca |
39438888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 46829212 - 46829168
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
46829212 |
ttttggttttggtccctgactccacttttgtgatgatttgcacac |
46829168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 1559702 - 1559647
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
1559702 |
taaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgtaa |
1559647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 2945842 - 2945787
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| ||||||||| | |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
2945842 |
taaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
2945787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 5234201 - 5234146
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| | |||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
5234201 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
5234146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 5308326 - 5308381
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
5308326 |
taaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaa |
5308381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 6509211 - 6509266
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
6509211 |
taaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgtaa |
6509266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 6509467 - 6509412
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
6509467 |
taaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
6509412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 6911085 - 6911140
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| ||||||||||| ||||||| ||||||||| ||||||||||||||| |
|
|
| T |
6911085 |
taaaatatgattttggtccttataaatatgtctcgttttgattttagtccttgtaa |
6911140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 8555796 - 8555741
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
8555796 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
8555741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 11767272 - 11767217
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || ||||| ||||||||| ||||| |
|
|
| T |
11767272 |
taaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgtaa |
11767217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 14543713 - 14543768
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
14543713 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccatgtaa |
14543768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 995 - 1046
Target Start/End: Original strand, 16940769 - 16940820
Alignment:
| Q |
995 |
atatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
16940769 |
atatggttttggtccctgcaaatatgcctcggtttggttttagtccctgtaa |
16940820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 17999468 - 17999523
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||| |||| ||||| |
|
|
| T |
17999468 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgtaa |
17999523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 19561157 - 19561204
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
19561157 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 19561447 - 19561392
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
19561447 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
19561392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 19783818 - 19783873
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| ||||| |||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
19783818 |
taaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
19783873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 20388277 - 20388332
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
20388277 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaa |
20388332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 21554396 - 21554451
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| || ||||||||||||||||| ||||||||||||||| |
|
|
| T |
21554396 |
taaaatatgattttagtccctgaaaatatgcctcgttttggttttagtccttgtaa |
21554451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 21554750 - 21554695
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
21554750 |
taaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaa |
21554695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 25547487 - 25547432
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
25547487 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
25547432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 28262716 - 28262771
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||| ||| ||||| |
|
|
| T |
28262716 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgtaa |
28262771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 28911580 - 28911635
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
28911580 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaa |
28911635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 30709328 - 30709383
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| | |||||||||||||||||| ||||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtccttgtaa |
30709383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 31732104 - 31732159
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
31732104 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgtaa |
31732159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 32189387 - 32189332
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
32189387 |
taaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
32189332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 35210512 - 35210457
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
35210512 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35210457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 37372901 - 37372854
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
37372901 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
37372854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 39520401 - 39520456
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| | |||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
39520401 |
taaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgtaa |
39520456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 39832909 - 39832964
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
39832909 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
39832964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 39833233 - 39833178
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
39833233 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaa |
39833178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 44344786 - 44344731
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
44344786 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
44344731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 45073638 - 45073583
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
45073638 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45073583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 46648712 - 46648657
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
46648712 |
taaaatatggttttagtctctgcaaatatgcctcgttttggttttaatccttgtaa |
46648657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 46828947 - 46829002
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| || |||||| ||||||||| ||||| |
|
|
| T |
46828947 |
taaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
46829002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 48359072 - 48359017
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||| ||||||| |
|
|
| T |
48359072 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcttgtaa |
48359017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 986 - 1040
Target Start/End: Original strand, 34877772 - 34877826
Alignment:
| Q |
986 |
aaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||| ||||||||||||||||||| || ||||||| ||||||||| ||||||||| |
|
|
| T |
34877772 |
aaagttaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtcc |
34877826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 992 - 1046
Target Start/End: Original strand, 37372441 - 37372495
Alignment:
| Q |
992 |
aaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
37372495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 982 - 1040
Target Start/End: Complemental strand, 44568696 - 44568638
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||| | ||||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
44568696 |
tttaaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtcc |
44568638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 3975742 - 3975697
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
3975742 |
attttggttttggtccctgactccacttttgtaatgatttgcacac |
3975697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 5355021 - 5354976
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
5355021 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
5354976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 8144561 - 8144516
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
8144561 |
attttggttttgatccctggctccacttttgtgataatttgcacac |
8144516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 9659358 - 9659407
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
9659358 |
taaaatatggttttgctccctgcaaatatgtctcgttttgattttagtcc |
9659407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 14739001 - 14738952
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
14739001 |
taaaatatggttttagtccctgcaaatatgcttcgttttgattttagtcc |
14738952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 16940859 - 16940904
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
16940859 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
16940904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 21223745 - 21223696
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||| |||||||||| ||||||||| |
|
|
| T |
21223745 |
taaaatatggttttagtccctgcaaatatacctcgttttggttttagtcc |
21223696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 27458496 - 27458541
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
27458496 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
27458541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 29198306 - 29198355
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| ||||||||| |
|
|
| T |
29198306 |
taaaatatggttttggtccctgcaaatatatctcgttttggttttagtcc |
29198355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 30223464 - 30223513
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| ||||||||| |
|
|
| T |
30223464 |
taaaatatggttttggtccccgcaaatatgtctcgttttggttttagtcc |
30223513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 30352563 - 30352612
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||| ||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtcc |
30352612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 30352901 - 30352852
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
30352901 |
taaaatatagttttagtccctgcaaatatgcctcgttttgattttagtcc |
30352852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1075 - 1116
Target Start/End: Original strand, 35665973 - 35666014
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgca |
1116 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
35665973 |
ttttggttttggtccctgaccccacttttgtgatgatttgca |
35666014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 39439026 - 39438977
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||| | ||||||||| ||||||||| |
|
|
| T |
39439026 |
taaaatatggttttggtccctgcaaatacgtctcgttttggttttagtcc |
39438977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 39520495 - 39520540
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
39520495 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
39520540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 44568329 - 44568378
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| ||||||||| |
|
|
| T |
44568329 |
taaaatatggttttggtccctgcaaatataactcgttttggttttagtcc |
44568378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 994 - 1046
Target Start/End: Original strand, 488720 - 488771
Alignment:
| Q |
994 |
aatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttg-gtttagtccttgtaa |
488771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 2945747 - 2945703
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
2945747 |
ttttggttttggtccctggccccacttttgtgatgatttgcacac |
2945703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 23816673 - 23816721
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| |||||||| |
|
|
| T |
23816673 |
taaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
23816721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 28529171 - 28529127
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||||| ||| | |||||||||||||||||||||||| |
|
|
| T |
28529171 |
ttttggttttgatcactggctccacttttgtgatgatttgcacac |
28529127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 31503780 - 31503732
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| |||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
31503732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 35104116 - 35104160
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
35104116 |
ttttggttttagtccctgactccacttttgtgatgatttgcacac |
35104160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1074 - 1118
Target Start/End: Complemental strand, 41054079 - 41054035
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
41054079 |
attttggttttggtccctggctccacttttgtgatgatttgcaca |
41054035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 1974012 - 1974067
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
1974012 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
1974067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 992 - 1039
Target Start/End: Original strand, 6954862 - 6954909
Alignment:
| Q |
992 |
aaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||| |||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtc |
6954909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 10358004 - 10358059
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| | || |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
10358004 |
taaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
10358059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 13770078 - 13770031
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| ||||||| ||||||| |
|
|
| T |
13770078 |
taaaatatggttttagtccctgcaaatatgccccgttttggttttagt |
13770031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 17854152 - 17854207
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
17854152 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgtaa |
17854207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 25547256 - 25547303
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 35470277 - 35470222
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||| |||||||| ||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
35470277 |
taaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgtaa |
35470222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 37527419 - 37527364
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| | |||||||| || |||||| ||||||||| ||||| |
|
|
| T |
37527419 |
taaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgtaa |
37527364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 39719639 - 39719584
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
39719639 |
taaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgtaa |
39719584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 44402963 - 44403018
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| | ||||| ||||||||| ||||| |
|
|
| T |
44402963 |
taaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgtaa |
44403018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1030
Target Start/End: Original strand, 45021497 - 45021536
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
1030 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
45021497 |
taaaatatggttttagtccctgcaaatatgcctcgttttg |
45021536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 45021853 - 45021806
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||| ||||||| |
|
|
| T |
45021853 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 45073317 - 45073372
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||||||| ||||| ||| ||||| |
|
|
| T |
45073317 |
taaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgtaa |
45073372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1042
Target Start/End: Original strand, 46304089 - 46304140
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcctt |
1042 |
Q |
| |
|
||||||||| |||| || | |||||||||||||||||||| ||||||||||| |
|
|
| T |
46304089 |
taaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcctt |
46304140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 46829309 - 46829254
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
46829309 |
taaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgtaa |
46829254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 985 - 1039
Target Start/End: Complemental strand, 7432255 - 7432201
Alignment:
| Q |
985 |
aaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||| |||||||||||||| | | |||||||||||||||||||| |||||||| |
|
|
| T |
7432255 |
aaaagttaaaatatggttttaattcctgcaaatatgcctcgttttgattttagtc |
7432201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1045
Target Start/End: Original strand, 35665880 - 35665934
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgta |
1045 |
Q |
| |
|
|||||||||||||| ||| | |||||||||||||||||| ||||||||| |||| |
|
|
| T |
35665880 |
taaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgta |
35665934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1041
Target Start/End: Original strand, 43300615 - 43300665
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcct |
1041 |
Q |
| |
|
|||||||||||||| || | |||||||||| ||||||||| |||||||||| |
|
|
| T |
43300615 |
taaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcct |
43300665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1029
Target Start/End: Complemental strand, 44841711 - 44841673
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgtttt |
1029 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
44841711 |
taaaatatggttttggtccctgcaaatatgactcgtttt |
44841673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 1081 - 1119
Target Start/End: Complemental strand, 46759869 - 46759831
Alignment:
| Q |
1081 |
ttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
46759869 |
ttttggtccctgactccacttttgtgatgatttgcacac |
46759831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1036
Target Start/End: Original strand, 1559346 - 1559391
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
1559346 |
taaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
1559391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 6911244 - 6911199
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
||||||||||||||||| | ||||||||| |||||||||| ||||| |
|
|
| T |
6911244 |
taaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 11767014 - 11767059
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
11767014 |
attttggttttggtccctagctccacttttgtgatgatttgcacac |
11767059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 20355411 - 20355460
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||||||||| || |||||| |
|
|
| T |
20355411 |
taaaatatgattttgatccttgcaaatatgactcgttttggttgtagtcc |
20355460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 23399709 - 23399754
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
23399709 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
23399754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 23676229 - 23676274
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
23676229 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
23676274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 24717529 - 24717480
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| | | |||||| ||||||||| ||||||||| |
|
|
| T |
24717529 |
taaaatatggttttggtccctaccaatatgtctcgttttggttttagtcc |
24717480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 25988652 - 25988607
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
25988652 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
25988607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 26877681 - 26877730
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||| ||||||||| |
|
|
| T |
26877681 |
taaaatatggttttgatctctgcaaatatgtctcgttttggttttagtcc |
26877730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 26877775 - 26877820
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
26877775 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
26877820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 30223558 - 30223603
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
30223558 |
attttggttttggtccctagctccacttttgtgatgatttgcacac |
30223603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 34878122 - 34878077
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||| |
|
|
| T |
34878122 |
taaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 35470183 - 35470138
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | | |||||||||||||||||||||| |
|
|
| T |
35470183 |
attttggttttggtccctggctctacttttgtgatgatttgcacac |
35470138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1001 - 1046
Target Start/End: Complemental strand, 41054163 - 41054118
Alignment:
| Q |
1001 |
ttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
41054118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 44568423 - 44568468
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
44568423 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
44568468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 45228618 - 45228667
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| ||||||||| |
|
|
| T |
45228618 |
taaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtcc |
45228667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 45671545 - 45671496
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
45671545 |
taaaatatggttttagtcattgcaaatatgtctcgttttagttttagtcc |
45671496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 7e-18; HSPs: 145)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 9532532 - 9532477
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaa |
9532477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 20660951 - 20661006
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20660951 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccttgtaa |
20661006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 5e-16
Query Start/End: Original strand, 985 - 1041
Target Start/End: Complemental strand, 2636996 - 2636940
Alignment:
| Q |
985 |
aaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcct |
1041 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
2636996 |
aaaagctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcct |
2636940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 1104861 - 1104916
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
1104861 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
1104916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 5904011 - 5904066
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
5904011 |
taaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgtaa |
5904066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 10743727 - 10743782
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10743727 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
10743782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 14318048 - 14318103
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
14318048 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccttgtaa |
14318103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 16038380 - 16038435
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16038380 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
16038435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 18046345 - 18046290
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18046345 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
18046290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 18258524 - 18258469
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
18258524 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
18258469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 19685377 - 19685322
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
19685377 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
19685322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 24443741 - 24443686
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
24443741 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24443686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 38170517 - 38170572
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
38170517 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38170572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 1105145 - 1105096
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
1105145 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
1105096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 1381608 - 1381559
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
1381608 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
1381559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 5917457 - 5917408
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
5917457 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
5917408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 6912500 - 6912549
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
6912500 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
6912549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 19565828 - 19565779
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
19565828 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
19565779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 20985728 - 20985777
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
20985777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 20986086 - 20986037
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
20986086 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
20986037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 35928067 - 35928116
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35928067 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
35928116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 40764418 - 40764467
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
40764418 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
40764467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 982 - 1046
Target Start/End: Original strand, 2217488 - 2217552
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||| | |||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
2217488 |
tttaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2217552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 45141 - 45196
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
45141 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
45196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 293831 - 293886
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
293831 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccatgtaa |
293886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 1381250 - 1381305
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
1381250 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
1381305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 5614169 - 5614224
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
5614169 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
5614224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 5950179 - 5950234
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
5950179 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
5950234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 6912854 - 6912799
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
6912854 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
6912799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 7075575 - 7075630
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
7075575 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
7075630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 9179917 - 9179862
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
9179917 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgtaa |
9179862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 10744051 - 10743996
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
10744051 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaa |
10743996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 11799455 - 11799400
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
11799455 |
taaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgtaa |
11799400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 13990892 - 13990837
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||| |||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13990892 |
taaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
13990837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 20661308 - 20661253
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
20661308 |
taaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgtaa |
20661253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 28108159 - 28108104
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
28108104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 28213376 - 28213431
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
28213376 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccatgtaa |
28213431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 28863513 - 28863568
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
28863513 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28863568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 28863835 - 28863780
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
28863835 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28863780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 29692747 - 29692802
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
29692747 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29692802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 30800497 - 30800552
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
30800497 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30800552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 30800847 - 30800792
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
30800847 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30800792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 34125310 - 34125365
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34125310 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
34125365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 35609306 - 35609361
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
35609306 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgtaa |
35609361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 35928455 - 35928400
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
35928455 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35928400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 36578080 - 36578025
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
36578080 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
36578025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 37271362 - 37271417
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
37271362 |
taaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaa |
37271417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 40029494 - 40029439
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
40029494 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
40029439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 991 - 1045
Target Start/End: Original strand, 30888163 - 30888217
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgta |
1045 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
30888163 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
30888217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 2217851 - 2217802
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
2217851 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
2217802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 5917129 - 5917178
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
5917129 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
5917178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 10408931 - 10408980
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
10408931 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
10408980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 18633602 - 18633651
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
18633602 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18633651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 19565470 - 19565519
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
19565470 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19565519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 19685020 - 19685069
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
19685020 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19685069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 24443383 - 24443432
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
24443383 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24443432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 28550830 - 28550879
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
28550830 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
28550879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 29172526 - 29172575
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29172526 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
29172575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 29172883 - 29172834
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29172883 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
29172834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 29875722 - 29875673
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29875722 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
29875673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 35167162 - 35167113
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35167162 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35167113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 35876691 - 35876740
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
35876691 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
35876740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 37271703 - 37271654
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
37271703 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttagtcc |
37271654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 40764777 - 40764728
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
40764777 |
taaaatatggttttgctccctgcaaatatgcctcgttttggttttagtcc |
40764728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 10409323 - 10409275
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
10409323 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10409275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 10830627 - 10830671
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
10830627 |
ttttggttttggtccctgaccccacttttgtgatgatttgcacac |
10830671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 20661046 - 20661090
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
20661046 |
ttttggttttggtccctgaccccacttttgtgatgatttgcacac |
20661090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 20690736 - 20690784
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
20690736 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20690784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1043
Target Start/End: Complemental strand, 39379607 - 39379555
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
39379607 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttg |
39379555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 1286685 - 1286740
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||| ||||||| | |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
1286685 |
taaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
1286740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 4203459 - 4203506
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
4203459 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 4203767 - 4203712
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
4203767 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
4203712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 4736539 - 4736484
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
4736539 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaa |
4736484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 5614527 - 5614480
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
5614527 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
5614480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 9179596 - 9179651
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
9179596 |
taaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgtaa |
9179651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 18046041 - 18046096
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
18046041 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
18046096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 21050910 - 21050855
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
21050910 |
taaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgtaa |
21050855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 26133186 - 26133241
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
26133186 |
taaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
26133241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 26133410 - 26133355
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
26133410 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
26133355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 28871991 - 28871944
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
28871991 |
taaattatggttttggtccctgcaaatatgcctcgttttggttttagt |
28871944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 29693087 - 29693032
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29693087 |
taaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttgtaa |
29693032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 29855616 - 29855671
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
29855616 |
taaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgtaa |
29855671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 33336023 - 33335968
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
33336023 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaa |
33335968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 35609634 - 35609587
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||| |
|
|
| T |
35609634 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 35877049 - 35876994
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||||| || ||||| |
|
|
| T |
35877049 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgtaa |
35876994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 36577725 - 36577780
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
36577725 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
36577780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 36973707 - 36973652
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
36973707 |
taaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgtaa |
36973652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 38786162 - 38786217
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
38786162 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
38786217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 40038497 - 40038552
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
40038497 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttaatccgtgtaa |
40038552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 40167789 - 40167844
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||| ||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
40167789 |
taaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
40167844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 42207245 - 42207300
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
42207245 |
taaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgtaa |
42207300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 42596814 - 42596759
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgtaa |
42596759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 991 - 1041
Target Start/End: Complemental strand, 23382294 - 23382244
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcct |
1041 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
23382294 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagtcct |
23382244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 992 - 1046
Target Start/End: Original strand, 32888691 - 32888745
Alignment:
| Q |
992 |
aaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctgtaa |
32888745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 2636766 - 2636811
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
2636766 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
2636811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 6118496 - 6118451
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
6118496 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
6118451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 15635704 - 15635655
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
15635704 |
taaaatatggttttagtccccgcaaatatgcctcgttttggttttagtcc |
15635655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 18258165 - 18258214
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||| ||||||||| |
|
|
| T |
18258165 |
taaaatatggttttggtccctgcaaatatggctcattttggttttagtcc |
18258214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 18258260 - 18258305
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||| |||||||||| |
|
|
| T |
18258260 |
attttggttttgatccctgactcgacttttgtgataatttgcacac |
18258305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 18633958 - 18633913
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
18633958 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18633913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 25561708 - 25561757
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
25561708 |
taaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
25561757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 25561996 - 25561951
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
25561996 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 29151519 - 29151568
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29151519 |
taaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc |
29151568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 37271609 - 37271564
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||| |
|
|
| T |
37271609 |
attttggttttggtccctgactccacttttgtgataatttgcacac |
37271564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 38452393 - 38452348
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
38452393 |
taaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 39379242 - 39379291
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
39379291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 2636672 - 2636720
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||| | ||||||||| |||||||| |
|
|
| T |
2636672 |
taaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1035
Target Start/End: Complemental strand, 12145180 - 12145136
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttt |
1035 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||| |
|
|
| T |
12145180 |
taaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 16038737 - 16038689
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
16038737 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
16038689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 17070633 - 17070677
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
17070633 |
ttttggttttggcccctgaccccacttttgtgatgatttgcacac |
17070677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 27916761 - 27916713
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| |||||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtc |
27916713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 993 - 1040
Target Start/End: Complemental strand, 3850594 - 3850547
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
3850594 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
3850547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1030
Target Start/End: Original strand, 4736208 - 4736247
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
1030 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
4736208 |
taaaatatggttttggtctttgcaaatatgtctcgttttg |
4736247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 989 - 1040
Target Start/End: Original strand, 15635377 - 15635428
Alignment:
| Q |
989 |
gataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| || |||||| ||||||||| |
|
|
| T |
15635377 |
gataaaatatggttttagtccatgcaaatatgtcttgttttggttttagtcc |
15635428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 1075 - 1118
Target Start/End: Original strand, 15916384 - 15916427
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
15916384 |
ttttggttttggtccctgacctcacttttgtgatgatttgcaca |
15916427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 17070538 - 17070592
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| |||| ||||||||| ||||| |
|
|
| T |
17070538 |
taaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctgtaa |
17070592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 20683750 - 20683805
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
20683750 |
taaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgtaa |
20683805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 21124916 - 21124971
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
21124916 |
taaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaa |
21124971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 29151848 - 29151801
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||| ||||||| |
|
|
| T |
29151848 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
29151801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 29366946 - 29366899
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||| |
|
|
| T |
29366946 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
29366899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 34125629 - 34125574
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
34125629 |
taaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaa |
34125574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 38962809 - 38962864
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| || ||||||| ||||||||| ||||||| ||||||| |
|
|
| T |
38962809 |
taaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcttgtaa |
38962864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 40038855 - 40038800
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| |||||| ||||| ||| ||||| |
|
|
| T |
40038855 |
taaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgtaa |
40038800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 1074 - 1116
Target Start/End: Complemental strand, 1286950 - 1286908
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgca |
1116 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
1286950 |
attttggttttggtccctgtccccacttttgtgatgatttgca |
1286908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1045
Target Start/End: Original strand, 12144910 - 12144964
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgta |
1045 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| ||||| ||||||||| |||| |
|
|
| T |
12144910 |
taaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgta |
12144964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1037
Target Start/End: Original strand, 35166914 - 35166960
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttag |
1037 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| |||||| |
|
|
| T |
35166914 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 1081 - 1119
Target Start/End: Original strand, 35609377 - 35609415
Alignment:
| Q |
1081 |
ttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
35609377 |
ttttggtccctgtcgccacttttgtgatgatttgcacac |
35609415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| ||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 1105051 - 1105006
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||| |||||||||||||||||||| |
|
|
| T |
1105051 |
attttggttttggtccctggctccaattttgtgatgatttgcacac |
1105006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 1381514 - 1381469
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
1381514 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
1381469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 4736445 - 4736400
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||| ||||||| |
|
|
| T |
4736445 |
attttggtttttgtccctgactccacttttgtgatgatctgcacac |
4736400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 5917362 - 5917317
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
5917362 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
5917317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 11799132 - 11799181
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| | |||||| ||||||||| |
|
|
| T |
11799132 |
taaaatatggttttagtccctgcaaatatgcattgttttggttttagtcc |
11799181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 15916289 - 15916338
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||| ||||||||||||| |||||||||| ||| ||||| ||||||||| |
|
|
| T |
15916289 |
taaaagatggttttggtccctgcaaatatgtctcattttggttttagtcc |
15916338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 19685113 - 19685158
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
19685113 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
19685158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 20985822 - 20985867
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| |||||||||| |
|
|
| T |
20985822 |
attttggttttgatccctggcttcacttttgtgataatttgcacac |
20985867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 24443477 - 24443522
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
24443477 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
24443522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 24781992 - 24782041
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
24781992 |
taaaatatggttttagtcactgcaaatatgtctcgttttggttttagtcc |
24782041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 29875403 - 29875452
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29875403 |
taaaatatgattttaatccctgcaaatatgcctcgttttggttttagtcc |
29875452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 31037738 - 31037693
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||| |
|
|
| T |
31037738 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 35928161 - 35928206
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
35928161 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
35928206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 38496779 - 38496730
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||| ||||||||| |
|
|
| T |
38496779 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtcc |
38496730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 38555080 - 38555032
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
38555080 |
taaaatatggttt-ggtccctgcaaatatgcctcattttggttttagtcc |
38555032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 42207569 - 42207521
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
42207569 |
taaaatatggttttagtccta-caaatatgcctcgttttggttttagtcc |
42207521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1036
Target Start/End: Original strand, 42994071 - 42994116
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||| |
|
|
| T |
42994071 |
taaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 7e-18; HSPs: 205)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 48730614 - 48730559
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48730614 |
taaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtccttgtaa |
48730559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 11822007 - 11822062
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11822007 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
11822062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 15058421 - 15058476
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
15058421 |
taaaatatggttttggtccctgcaaatatgactcgttttggttttagtccttgtaa |
15058476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 24507840 - 24507785
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
24507840 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24507785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 26207281 - 26207336
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
26207281 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgtaa |
26207336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 33000308 - 33000363
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
33000308 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
33000363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 33045687 - 33045632
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
33045687 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
33045632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 38151209 - 38151154
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
38151209 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38151154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 44157698 - 44157753
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
44157698 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
44157753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 992 - 1046
Target Start/End: Complemental strand, 24649656 - 24649602
Alignment:
| Q |
992 |
aaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
24649656 |
aaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
24649602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 986 - 1040
Target Start/End: Original strand, 32420096 - 32420150
Alignment:
| Q |
986 |
aaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
32420096 |
aaagctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtcc |
32420150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 982 - 1040
Target Start/End: Complemental strand, 47819602 - 47819544
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||| | ||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
47819602 |
tttaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
47819544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 3247559 - 3247510
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3247510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 24653805 - 24653854
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
24653805 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
24653854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 38163934 - 38163983
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
38163983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 38164292 - 38164243
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
38164292 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
38164243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 47819235 - 47819284
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
47819235 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
47819284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 991 - 1043
Target Start/End: Complemental strand, 35005741 - 35005689
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
35005741 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
35005689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 3247201 - 3247256
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
3247201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
3247256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 3753216 - 3753271
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
3753216 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3753271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 984 - 1039
Target Start/End: Original strand, 4323824 - 4323879
Alignment:
| Q |
984 |
taaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||| |||||||||||||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
4323824 |
taaaagctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
4323879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 4789311 - 4789366
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
4789311 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
4789366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 5058989 - 5058934
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| ||||||||| ||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgtaa |
5058934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 7350733 - 7350678
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtccttgtaa |
7350678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 8140437 - 8140492
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
8140437 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
8140492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 10631167 - 10631222
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
10631167 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
10631222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 11822362 - 11822307
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
11822362 |
taaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgtaa |
11822307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 12360965 - 12360910
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
12360965 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
12360910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 13770492 - 13770547
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
13770492 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13770547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1030
Target Start/End: Complemental strand, 15211855 - 15211816
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
1030 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15211855 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
15211816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 16060882 - 16060827
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
16060882 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
16060827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 18079401 - 18079456
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
18079401 |
taaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgtaa |
18079456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 18302384 - 18302329
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
18302384 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
18302329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 19720715 - 19720770
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
19720715 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
19720770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 22919687 - 22919742
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
22919687 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
22919742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 26191362 - 26191417
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
26191362 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaa |
26191417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 26191731 - 26191676
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
26191731 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
26191676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 26324588 - 26324643
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
26324588 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
26324643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 26442896 - 26442841
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
26442896 |
taaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgtaa |
26442841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 29072500 - 29072555
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
29072500 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29072555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 32906237 - 32906182
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||| |||||||| |||||| |
|
|
| T |
32906237 |
taaaatatgattttggtccttgcaaatatgtctcgttttgattttagtcattgtaa |
32906182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 33234549 - 33234604
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
33234549 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
33234604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 33234909 - 33234854
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
33234909 |
taaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
33234854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 35308108 - 35308053
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
35308108 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
35308053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 39747832 - 39747777
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
39747832 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
39747777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 45368493 - 45368548
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
45368493 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45368548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 50428876 - 50428931
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
50428876 |
taaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgtaa |
50428931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 52254186 - 52254241
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52254186 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgtaa |
52254241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 52254476 - 52254421
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
52254476 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
52254421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1040
Target Start/End: Original strand, 44641076 - 44641130
Alignment:
| Q |
986 |
aaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
44641076 |
aaagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
44641130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 990376 - 990327
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
990376 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
990327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 1810930 - 1810979
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
1810930 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1810979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 7001894 - 7001845
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
7001894 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
7001845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 8140796 - 8140747
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| ||||||||| |
|
|
| T |
8140796 |
taaaatatggttttggtacctgcaaatatgcctcgttttggttttagtcc |
8140747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 10631525 - 10631476
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
10631525 |
taaaatatggttttggtccctgcaaatatggctcgttttggttttagtcc |
10631476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 10887595 - 10887546
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
10887595 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
10887546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 15516585 - 15516634
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
15516585 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
15516634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 15526359 - 15526310
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
15526359 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
15526310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 16026935 - 16026886
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
16026935 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
16026886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 18473275 - 18473324
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
18473275 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18473324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 18473592 - 18473543
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
18473592 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18473543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 19721071 - 19721022
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
19721022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 24507482 - 24507531
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
24507482 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
24507531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 24977781 - 24977830
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
24977781 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
24977830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 26061959 - 26062008
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
26061959 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
26062008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 985 - 1046
Target Start/End: Original strand, 27521573 - 27521634
Alignment:
| Q |
985 |
aaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||| |||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
27521573 |
aaaagctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
27521634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 30322932 - 30322981
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
30322932 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
30322981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 30323290 - 30323241
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
30323290 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
30323241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 32729046 - 32728997
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
32729046 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
32728997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 33000666 - 33000617
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
33000666 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
33000617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 33379891 - 33379940
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
33379891 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
33379940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 35005447 - 35005496
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35005447 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
35005496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 35056533 - 35056582
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
35056533 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35056582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 35056891 - 35056842
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35056891 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
35056842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 37545631 - 37545680
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
37545631 |
taaaatatggttttagtccatgcaaatatgcctcgttttggttttagtcc |
37545680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 38136978 - 38136929
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
38136978 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
38136929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 38150851 - 38150900
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
38150900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 40718113 - 40718162
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
40718113 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
40718162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 41358372 - 41358421
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
41358372 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
41358421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 45380275 - 45380324
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
45380275 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
45380324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 45380633 - 45380584
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
45380633 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
45380584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 45638583 - 45638632
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
45638583 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
45638632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 46183687 - 46183736
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
46183687 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
46183736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1036
Target Start/End: Original strand, 49073694 - 49073739
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
49073694 |
taaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
49073739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 49073956 - 49073911
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
49073956 |
attttggttttggtccctgaccccacttttgtgatgatttgcacac |
49073911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 17129986 - 17129942
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
17129986 |
ttttggttttggtccctgactccacttttgtgatgatttgcacac |
17129942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 986 - 1046
Target Start/End: Complemental strand, 19198951 - 19198891
Alignment:
| Q |
986 |
aaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
19198951 |
aaagctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgtaa |
19198891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 997 - 1040
Target Start/End: Original strand, 292868 - 292911
Alignment:
| Q |
997 |
atggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
292868 |
atggttttagtccctgcaaatatgcctcgttttgcttttagtcc |
292911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 3679629 - 3679684
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
3679629 |
taaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
3679684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 6567493 - 6567438
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
6567493 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
6567438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 7867132 - 7867187
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
7867132 |
taaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaa |
7867187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 12322607 - 12322662
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
12322607 |
taaaatatggttttgatccctgcaaatatgtttcgttttgattttagtccttgtaa |
12322662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 12322967 - 12322912
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||| ||| ||||| |
|
|
| T |
12322967 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgtaa |
12322912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 1075 - 1118
Target Start/End: Original strand, 12360701 - 12360744
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
12360701 |
ttttggttttggtccctgaccccacttttgtgatgatttgcaca |
12360744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 12361014 - 12361069
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||| |||||||||||| ||||||||| ||||| |
|
|
| T |
12361014 |
taaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgtaa |
12361069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 14007492 - 14007547
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
14007492 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
14007547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 17129692 - 17129747
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| | | |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
17129692 |
taaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgtaa |
17129747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 18900130 - 18900075
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaa |
18900075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 22674206 - 22674261
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||| ||||| |||||||||| ||||||||| |||||||| |||||| |
|
|
| T |
22674206 |
taaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtctttgtaa |
22674261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 22919974 - 22919919
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22919974 |
taaaatatggttttagtctctgcaaatatgcctcgttttagttttagtccttgtaa |
22919919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 24978119 - 24978072
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
24978119 |
taaaatatagttttggtcctggcaaatatgcctcgttttggttttagt |
24978072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 26442566 - 26442621
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
26442566 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccatgtaa |
26442621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 29072859 - 29072804
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
29072859 |
taaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgtaa |
29072804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 29579323 - 29579378
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
29579323 |
taaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctgtaa |
29579378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 32454291 - 32454236
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||||| ||||| |
|
|
| T |
32454291 |
taaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgtaa |
32454236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 33045358 - 33045413
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
33045358 |
taaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgtaa |
33045413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 35307718 - 35307765
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
35307718 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35307765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 41738799 - 41738854
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
41738799 |
taaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgtaa |
41738854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 44641429 - 44641374
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
44641429 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
44641374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 48956063 - 48956008
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
48956063 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaa |
48956008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 50429206 - 50429151
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
50429206 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
50429151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 50799133 - 50799188
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
50799133 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
50799188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 982 - 1040
Target Start/End: Complemental strand, 3753578 - 3753520
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||| | |||||||||||||| |||| || ||||||||||||||||| ||||||||| |
|
|
| T |
3753578 |
tttaaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
3753520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 991 - 1041
Target Start/End: Complemental strand, 17130080 - 17130030
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcct |
1041 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||| |||| |
|
|
| T |
17130080 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttaatcct |
17130030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 991 - 1037
Target Start/End: Original strand, 24649353 - 24649399
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttag |
1037 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||| |
|
|
| T |
24649353 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
24649399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 991 - 1037
Target Start/End: Complemental strand, 24654164 - 24654118
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttag |
1037 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
24654164 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
24654118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 991 - 1041
Target Start/End: Original strand, 33067351 - 33067401
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcct |
1041 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| |||| ||||| |
|
|
| T |
33067351 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcct |
33067401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 990091 - 990140
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||| ||||||||| |
|
|
| T |
990091 |
taaaatatggttttagtccctacaaatatgcctcgttttggttttagtcc |
990140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 993 - 1046
Target Start/End: Original strand, 2939934 - 2939987
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaa |
2939987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 3679983 - 3679934
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3679983 |
taaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc |
3679934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 10631431 - 10631386
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||| |
|
|
| T |
10631431 |
attttggttttggtccctgactccacttttgtgataatttgcacac |
10631386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 10887236 - 10887285
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| ||||||||| |
|
|
| T |
10887236 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtcc |
10887285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 10887330 - 10887375
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
10887330 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
10887375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 13260318 - 13260269
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
13260318 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
13260269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 19622658 - 19622707
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
19622658 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19622707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 19623014 - 19622965
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
19623014 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
19622965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 19720977 - 19720932
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||| |
|
|
| T |
19720977 |
attttggttttggtccctgactccacttttgtgataatttgcacac |
19720932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 21391099 - 21391148
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
21391099 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
21391148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 29688425 - 29688376
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29688425 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
29688376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 31060790 - 31060839
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| || |||||| ||||||||| |
|
|
| T |
31060790 |
taaaatatggttttggtccctgcaaatatgtcttgttttggttttagtcc |
31060839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 31258342 - 31258391
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||||||| ||||||||| |
|
|
| T |
31258342 |
taaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
31258391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 31258699 - 31258650
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtcc |
31258650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 39025378 - 39025330
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
39025378 |
taaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtcc |
39025330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 40718471 - 40718422
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||| | |||||| ||||||||| |
|
|
| T |
40718471 |
taaaatatggttttggtccctgcaaatatgcatagttttgattttagtcc |
40718422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 44158039 - 44157990
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
44158039 |
taaaatatggtttttgtccctgcaaatatgcctagttttggttttagtcc |
44157990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 45290460 - 45290509
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
45290460 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
45290509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 45290817 - 45290768
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
45290817 |
taaaatatggttttagtccccgcaaatatgcctcgttttggttttagtcc |
45290768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 45638891 - 45638846
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
45638891 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1044
Target Start/End: Original strand, 48955717 - 48955770
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgt |
1044 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
48955717 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctttgt |
48955770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 8364878 - 8364834
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
8364878 |
ttttggttttcgtccctgaccccacttttgtgatgatttgcacac |
8364834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 15211514 - 15211562
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||| |||||||| |
|
|
| T |
15211514 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
15211562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 16060599 - 16060646
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
16060599 |
taaaatatggttttggtccct-caaatatgcctcgttttggttttagtc |
16060646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 17984336 - 17984384
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
17984336 |
taaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtc |
17984384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 17984698 - 17984650
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
17984698 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 982 - 1030
Target Start/End: Complemental strand, 18079666 - 18079618
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttg |
1030 |
Q |
| |
|
|||||| | |||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
18079666 |
tttaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 19198851 - 19198807
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
19198851 |
ttttggttttggtctctgaccccacttttgtgatgatttgcacac |
19198807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 26324849 - 26324805
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
26324849 |
ttttggttttcgtccctgaccccacttttgtgatgatttgcacac |
26324805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 26324944 - 26324896
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
26324944 |
taaaatatgattttagtccatgcaaatatgcctcgttttggttttagtc |
26324896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 32420195 - 32420239
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
32420195 |
ttttggttttggaccctgaccccacttttgtgatgatttgcacac |
32420239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 42482982 - 42483030
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||| |||||||| |
|
|
| T |
42482982 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
42483030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 48609591 - 48609543
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| |||||||| |
|
|
| T |
48609591 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
48609543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1035
Target Start/End: Complemental strand, 49074050 - 49074006
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttt |
1035 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
49074050 |
taaaatatggttttggtccttgtaaatatgcttcgttttgatttt |
49074006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 4565333 - 4565278
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||| |||||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
4565333 |
taaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgtaa |
4565278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1042
Target Start/End: Original strand, 7350426 - 7350477
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcctt |
1042 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||| ||||| ||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcctt |
7350477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 7818785 - 7818832
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
7818785 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 7867354 - 7867299
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| || ||||| ||||||||| ||||| |
|
|
| T |
7867354 |
taaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgtaa |
7867299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 12360606 - 12360661
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||| |||||| || ||||| |
|
|
| T |
12360606 |
taaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctgtaa |
12360661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 13259991 - 13260046
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
13259991 |
taaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgtaa |
13260046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 15335292 - 15335245
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
15335245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 15466135 - 15466190
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| ||||| ||||||||| ||||| |
|
|
| T |
15466135 |
taaaatatggttttggtccttacggatatgcctcattttggttttagtccctgtaa |
15466190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 18899842 - 18899889
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
18899889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 20756022 - 20756077
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||||| ||||||| ||||||||| ||||||||||||||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggttttagtccttgtaa |
20756077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 21383425 - 21383370
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
21383425 |
taaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctgtaa |
21383370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 25658017 - 25658072
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| ||||| ||| ||||| |
|
|
| T |
25658017 |
taaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgtaa |
25658072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 25658298 - 25658243
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| ||||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
25658298 |
taaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctgtaa |
25658243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 32626532 - 32626579
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||| |
|
|
| T |
32626532 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
32626579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 34002937 - 34002882
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| || |||||| ||||||||| ||||| |
|
|
| T |
34002937 |
taaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgtaa |
34002882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 34808200 - 34808255
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| | |||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgtaa |
34808255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1030
Target Start/End: Original strand, 36912856 - 36912895
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
1030 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
36912856 |
taaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 39303677 - 39303732
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||| |||| ||||||||| ||||||||| ||||| |
|
|
| T |
39303677 |
taaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgtaa |
39303732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 41358660 - 41358613
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||| |
|
|
| T |
41358660 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
41358613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 45368846 - 45368791
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
45368846 |
taaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
45368791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 48609239 - 48609294
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
48609239 |
taaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgtaa |
48609294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 993 - 1039
Target Start/End: Complemental strand, 16083394 - 16083348
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||| |||| ||||||||| |||||||||| |||||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagtc |
16083348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1045
Target Start/End: Original strand, 20948758 - 20948812
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgta |
1045 |
Q |
| |
|
||||||||||||||||||| | |||||||| ||||||| | ||||||||| |||| |
|
|
| T |
20948758 |
taaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgta |
20948812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1037
Target Start/End: Complemental strand, 22953553 - 22953507
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttag |
1037 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| |||||| |
|
|
| T |
22953553 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 1075 - 1113
Target Start/End: Original strand, 26699388 - 26699426
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgattt |
1113 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
26699388 |
ttttggttttgatctctgactccacttttgtgatgattt |
26699426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 1077 - 1119
Target Start/End: Complemental strand, 48730518 - 48730476
Alignment:
| Q |
1077 |
ttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
48730518 |
ttggctttggtccctgaccccacttttgtgatgatttgcacac |
48730476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1045
Target Start/End: Complemental strand, 49923815 - 49923761
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgta |
1045 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
49923815 |
taaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctgta |
49923761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 3247465 - 3247420
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
3247465 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
3247420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 8140701 - 8140656
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
8140701 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
8140656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 12158693 - 12158742
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
12158693 |
taaaatatggttttagtctctgcaaatatgcatcgttttggttttagtcc |
12158742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 16026841 - 16026796
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
16026841 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
16026796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 16060692 - 16060737
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||| ||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
16060692 |
attttgattttggtccctggctccacttttgtgatgatttgcacac |
16060737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 24507576 - 24507621
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
24507576 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
24507621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1075 - 1116
Target Start/End: Original strand, 24510040 - 24510081
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgca |
1116 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
24510040 |
ttttggttgtggtccctgaccccacttttgtgatgatttgca |
24510081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 24977876 - 24977921
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
24977876 |
attttggttttggtccctagctccacttttgtgatgatttgcacac |
24977921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 30323196 - 30323151
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
30323196 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
30323151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 31061054 - 31061009
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
31061054 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
31061009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 31061148 - 31061099
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| ||||||||| ||||||||| ||||||||| |
|
|
| T |
31061148 |
taaaatatggttttgatccctgcaaatatatctcgttttggttttagtcc |
31061099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 33000572 - 33000527
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
33000572 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
33000527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 33045453 - 33045498
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| ||| || | |||||||||||||||||||||||| |
|
|
| T |
33045453 |
attttggttttggtccatggctccacttttgtgatgatttgcacac |
33045498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 33067727 - 33067682
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
33067727 |
taaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 35056797 - 35056752
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
35056797 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
35056752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 37624749 - 37624798
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||| |||| |||| |
|
|
| T |
37624749 |
taaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 38136884 - 38136839
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
38136884 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
38136839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 38150945 - 38150990
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
38150945 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
38150990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 39747477 - 39747525
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||| | ||||||||| ||||||||| |
|
|
| T |
39747477 |
taaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtcc |
39747525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 39747570 - 39747615
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||| | | |||||||||||||||||||||||| |
|
|
| T |
39747570 |
attttggttttggtcccgggctccacttttgtgatgatttgcacac |
39747615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 40718377 - 40718332
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
40718377 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
40718332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 41881096 - 41881145
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| | |||||||| ||||||||| ||||||||| |
|
|
| T |
41881096 |
taaaatatggttttagtccctccaaatatgtctcgttttggttttagtcc |
41881145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 44157945 - 44157900
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| ||| || | |||||||||||||||||||||||| |
|
|
| T |
44157945 |
attttggttttggtccttggctccacttttgtgatgatttgcacac |
44157900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 45380369 - 45380414
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
45380369 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
45380414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 46868574 - 46868525
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
46868574 |
taaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
46868525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 1e-16; HSPs: 120)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 989 - 1046
Target Start/End: Original strand, 18024012 - 18024069
Alignment:
| Q |
989 |
gataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
18024012 |
gataaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgtaa |
18024069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 494408 - 494463
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
494408 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
494463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 1007506 - 1007451
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
1007506 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
1007451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 3276351 - 3276296
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
3276351 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
3276296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 3414390 - 3414445
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
3414390 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3414445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 3969006 - 3968951
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
3969006 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3968951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 14428653 - 14428708
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
14428653 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
14428708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 14428947 - 14428892
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
14428947 |
taaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccttgtaa |
14428892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 14656257 - 14656202
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
14656257 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgtaa |
14656202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 25137354 - 25137299
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
25137354 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25137299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 6412576 - 6412527
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
6412576 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
6412527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 15962030 - 15962079
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15962030 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
15962079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 21994400 - 21994351
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
21994400 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
21994351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 22543357 - 22543406
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
22543357 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
22543406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 985 - 1046
Target Start/End: Complemental strand, 30479425 - 30479364
Alignment:
| Q |
985 |
aaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||| ||||||||||||||||| | |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
30479425 |
aaaagctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgtaa |
30479364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 984 - 1040
Target Start/End: Original strand, 20467347 - 20467403
Alignment:
| Q |
984 |
taaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||| |||||||||| |||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
20467347 |
taaaggataaaatatagttttggtccctgcaaatatgcctcgttttggttttagtcc |
20467403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 1007127 - 1007182
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
1007127 |
taaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaa |
1007182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 3356145 - 3356200
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
3356145 |
taaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccttgtaa |
3356200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 8170148 - 8170093
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||||||| |||||| |
|
|
| T |
8170148 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcattgtaa |
8170093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 10910961 - 10910906
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
10910961 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
10910906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 11449166 - 11449111
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| || |||||| ||||| |
|
|
| T |
11449166 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgtaa |
11449111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 12299137 - 12299090
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
12299137 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
12299090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 13617532 - 13617587
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
13617532 |
taaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaa |
13617587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 15962386 - 15962331
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
15962386 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
15962331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 17771914 - 17771969
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
17771914 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaa |
17771969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 19321128 - 19321081
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
19321128 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 19690396 - 19690451
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
19690396 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
19690451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 20467715 - 20467668
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
20467715 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
20467668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 21147407 - 21147462
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
21147407 |
taaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgtaa |
21147462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 21995422 - 21995367
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
21995422 |
taaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgtaa |
21995367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1119
Target Start/End: Original strand, 25136997 - 25137135
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaannnnnnnnattatttttggtctctgcaa----------ttttgg |
1080 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| || ||||||||| |||||| |||||| |
|
|
| T |
25136997 |
taaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaattgttgtttttggtccctgcaaatatgcctcattttgg |
25137096 |
T |
 |
| Q |
1081 |
ttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
25137097 |
ttttggtccctggctccacttttgtgatgatttgcacac |
25137135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 985 - 1040
Target Start/End: Original strand, 31166867 - 31166922
Alignment:
| Q |
985 |
aaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||| |||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
31166867 |
aaaagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
31166922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 33131847 - 33131792
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
33131847 |
taaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgtaa |
33131792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 34582532 - 34582587
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
34582532 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
34582587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 986 - 1040
Target Start/End: Complemental strand, 3356500 - 3356446
Alignment:
| Q |
986 |
aaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3356500 |
aaagttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3356446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 991 - 1045
Target Start/End: Complemental strand, 26376042 - 26375988
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgta |
1045 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
26375988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 985 - 1046
Target Start/End: Complemental strand, 494755 - 494694
Alignment:
| Q |
985 |
aaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||| |||||||||||||| |||| |||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
494755 |
aaaagctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaa |
494694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 1890449 - 1890400
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
1890449 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
1890400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 3968648 - 3968697
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
3968648 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3968697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 6412221 - 6412270
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
6412221 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
6412270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 7156157 - 7156108
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
7156157 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
7156108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 13268112 - 13268161
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| | ||||||||| |
|
|
| T |
13268112 |
taaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtcc |
13268161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 15076201 - 15076152
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
15076201 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
15076152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 21385254 - 21385303
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
21385254 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
21385303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 21385581 - 21385532
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
21385581 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
21385532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 22543715 - 22543666
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
22543715 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
22543666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 22822648 - 22822599
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
22822648 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
22822599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 24274128 - 24274079
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
24274128 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
24274079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 24692976 - 24692927
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
24692976 |
taaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtcc |
24692927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 24901335 - 24901380
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
24901335 |
attttggttttggtccctgactccacttttgtgatgatttgcacac |
24901380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 31198618 - 31198667
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
31198618 |
taaaatatggttttggtccctgcaaatatggctcgttttggttttagtcc |
31198667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 33801740 - 33801691
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
33801740 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
33801691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 992 - 1040
Target Start/End: Original strand, 543365 - 543413
Alignment:
| Q |
992 |
aaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
543413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 12757613 - 12757661
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
12757613 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12757661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 13268207 - 13268251
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
13268207 |
ttttggttttggtccctgaccccacttttgtgatgatttgcacac |
13268251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1035
Target Start/End: Original strand, 23502240 - 23502284
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttt |
1035 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
23502240 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 24901242 - 24901290
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
24901242 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 7324189 - 7324134
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
7324134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 12176640 - 12176585
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
12176585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 12419711 - 12419766
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| |||||||||| |||| |
|
|
| T |
12419711 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcctggtaa |
12419766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 15442940 - 15442987
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||| ||||||| |
|
|
| T |
15442940 |
taaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 15722613 - 15722668
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
15722613 |
taaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgtaa |
15722668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 17765012 - 17765059
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||| |
|
|
| T |
17765012 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 18024372 - 18024317
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| || |||||| ||||||||| ||||| |
|
|
| T |
18024372 |
taaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
18024317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 19296404 - 19296349
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
19296404 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
19296349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 21993790 - 21993845
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
21993790 |
taaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaa |
21993845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 21995067 - 21995122
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
21995067 |
taaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgtaa |
21995122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 23770164 - 23770219
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
23770164 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
23770219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 25431851 - 25431796
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
25431851 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
25431796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 30928684 - 30928739
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
30928684 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
30928739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 30929041 - 30928986
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
30929041 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30928986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 34582889 - 34582834
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
34582889 |
taaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgtaa |
34582834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 34990312 - 34990257
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
34990257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 1000 - 1046
Target Start/End: Complemental strand, 13617804 - 13617758
Alignment:
| Q |
1000 |
gttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13617758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 994 - 1040
Target Start/End: Original strand, 19129342 - 19129388
Alignment:
| Q |
994 |
aatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
19129342 |
aatatggctttggtccctgcaaatatgcctcgttttggttttagtcc |
19129388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 992 - 1046
Target Start/End: Complemental strand, 19690755 - 19690702
Alignment:
| Q |
992 |
aaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgttttg-ttttagtccgtgtaa |
19690702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 991 - 1041
Target Start/End: Original strand, 34989964 - 34990014
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcct |
1041 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| |||||||||| |
|
|
| T |
34989964 |
taaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcct |
34990014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 1007221 - 1007266
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
1007221 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
1007266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 1890062 - 1890111
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||||||| ||||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtcc |
1890111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 2615875 - 2615924
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||| |||||||||| ||||||||| |
|
|
| T |
2615875 |
taaaatatggttttagtccctgcaaatatacctcgttttggttttagtcc |
2615924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 3414749 - 3414700
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||| ||||||||| |
|
|
| T |
3414749 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtcc |
3414700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 5286948 - 5286899
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
5286948 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
5286899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 7155800 - 7155849
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
7155800 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
7155849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 8680778 - 8680827
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
8680778 |
taaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtcc |
8680827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 8681113 - 8681064
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
8681113 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
8681064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1044
Target Start/End: Complemental strand, 9896634 - 9896581
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgt |
1044 |
Q |
| |
|
|||||||||||||| |||| |||||||||| || |||||| ||||||||||||| |
|
|
| T |
9896634 |
taaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgt |
9896581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 12298825 - 12298874
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| ||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtcc |
12298874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 12419935 - 12419886
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
12419935 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 14655382 - 14655431
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
14655382 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
14655431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 19267568 - 19267617
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| || |||||||| |||||||| ||||||||| |
|
|
| T |
19267568 |
taaaatatggttttggtccctgtaaatatgcttcgttttggttttagtcc |
19267617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 19320864 - 19320909
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
19320864 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
19320909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 22792896 - 22792847
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
22792896 |
taaaatatggttctagtccctgcaaatatgcctcgttttggttttagtcc |
22792847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 31167197 - 31167148
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
31167197 |
taaaatatggttttagtccctgcaaatatggctcgttttgattttagtcc |
31167148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 31198712 - 31198757
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
31198712 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
31198757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 32885676 - 32885725
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
32885676 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
32885725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 33808623 - 33808672
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||||||| ||||||||| |
|
|
| T |
33808623 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtcc |
33808672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 12298916 - 12298960
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
12298916 |
ttttggttttggtccctggccccacttttgtgatgatttgcacac |
12298960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 982 - 1046
Target Start/End: Original strand, 19296102 - 19296166
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||| | ||||| |||||||| |||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
19296102 |
tttaaaggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgtaa |
19296166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 10091039 - 10091094
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
10091094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 10910632 - 10910687
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||| | |||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
10910632 |
taaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgtaa |
10910687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 12612356 - 12612301
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
12612356 |
taaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgtaa |
12612301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 19320770 - 19320825
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||| ||||| ||| ||||| |
|
|
| T |
19320770 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctgtaa |
19320825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 23502537 - 23502482
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||| ||| ||||| |
|
|
| T |
23502537 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgtaa |
23502482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 24273831 - 24273878
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||| |
|
|
| T |
24273831 |
taaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
24273878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 25121493 - 25121438
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||| | |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
25121493 |
taaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgtaa |
25121438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 31186588 - 31186533
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| || | ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
31186588 |
taaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgtaa |
31186533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 31398538 - 31398483
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
31398538 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtccttgtaa |
31398483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1045
Target Start/End: Original strand, 2373182 - 2373236
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgta |
1045 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| || |||||| |||| |
|
|
| T |
2373182 |
taaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgta |
2373236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 1001 - 1043
Target Start/End: Complemental strand, 6564872 - 6564830
Alignment:
| Q |
1001 |
ttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
6564872 |
ttttggtccatgcaaatatgcctcgttttggttttggtccttg |
6564830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 985 - 1039
Target Start/End: Original strand, 23628795 - 23628849
Alignment:
| Q |
985 |
aaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||| |||||||| |||||||| |
|
|
| T |
23628795 |
aaaagctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtc |
23628849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1029
Target Start/End: Complemental strand, 23770436 - 23770398
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgtttt |
1029 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
23770436 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 1214993 - 1214944
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||| ||||||||| |
|
|
| T |
1214993 |
taaaatatggttttgatctctgcaaatatgtctcgttttggttttagtcc |
1214944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 3968742 - 3968787
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
3968742 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
3968787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 6412482 - 6412437
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
6412482 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
6412437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 6468313 - 6468362
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| | |||||| ||||||||| |
|
|
| T |
6468313 |
taaaatatggttttagtccctgcaaatatgctttgttttggttttagtcc |
6468362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 998 - 1039
Target Start/End: Complemental strand, 6564934 - 6564893
Alignment:
| Q |
998 |
tggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
6564934 |
tggttttggtccctgcaaatatgtctcgttttggttttagtc |
6564893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 20467448 - 20467493
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
20467448 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
20467493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 22543621 - 22543576
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
22543621 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
22543576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 25121400 - 25121355
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||| ||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
25121400 |
attttgattttggtccctggccccacttttgtgatgatttgcacac |
25121355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 31276139 - 31276184
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
31276139 |
attttggttttggtccctgacttcatttttgtgatgatttgcacac |
31276184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 5e-16; HSPs: 201)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 5e-16
Query Start/End: Original strand, 982 - 1046
Target Start/End: Complemental strand, 13530719 - 13530655
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||| | ||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
13530719 |
tttaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13530655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 13074122 - 13074067
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
13074122 |
taaaatatggttttggtccctgcaaatatacctcgttttggttttagtccttgtaa |
13074067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 22099546 - 22099601
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22099546 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
22099601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 24774048 - 24774103
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
24774048 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24774103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 43231386 - 43231331
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
43231386 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
43231331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 46115417 - 46115472
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
46115417 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
46115472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 46128551 - 46128606
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
46128551 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
46128606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 989 - 1040
Target Start/End: Original strand, 47022741 - 47022792
Alignment:
| Q |
989 |
gataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
47022741 |
gataaaatatggttttggtccttgcaaatatgtctcgttttggttttagtcc |
47022792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 982 - 1040
Target Start/End: Original strand, 29499176 - 29499234
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||| | ||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29499176 |
tttaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
29499234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 23245234 - 23245283
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
23245234 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
23245283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 29499543 - 29499494
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
29499494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 30046789 - 30046740
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
30046789 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
30046740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 30060772 - 30060821
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtcc |
30060821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 30061130 - 30061081
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
30061130 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
30061081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 35464379 - 35464330
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35464379 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
35464330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 42848388 - 42848339
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
42848388 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
42848339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 53915686 - 53915735
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
53915686 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
53915735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 994 - 1046
Target Start/End: Complemental strand, 5052578 - 5052526
Alignment:
| Q |
994 |
aatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5052578 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
5052526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 6827549 - 6827597
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
6827549 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 5827970 - 5827915
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
5827970 |
taaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgtaa |
5827915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 6353635 - 6353580
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
6353635 |
taaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgtaa |
6353580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 8760778 - 8760723
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
8760778 |
taaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgtaa |
8760723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 11693118 - 11693063
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
11693118 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgtaa |
11693063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 13064162 - 13064217
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
13064162 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
13064217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 13064462 - 13064407
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
13064462 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13064407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 13073762 - 13073817
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
13073762 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13073817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 13631231 - 13631286
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
13631231 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13631286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 14487805 - 14487860
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||| |||| ||||| |
|
|
| T |
14487805 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaa |
14487860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 16712688 - 16712633
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
16712688 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16712633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 19903652 - 19903597
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
19903652 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccatgtaa |
19903597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 25423927 - 25423982
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
25423927 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
25423982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 25424309 - 25424254
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
25424309 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
25424254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 28449211 - 28449156
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||| ||| ||||| |
|
|
| T |
28449211 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttaatccatgtaa |
28449156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 29380907 - 29380852
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
29380907 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
29380852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 34361806 - 34361861
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
34361806 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
34361861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 35420700 - 35420645
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||| ||||||||| ||||| |
|
|
| T |
35420700 |
taaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgtaa |
35420645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 35464021 - 35464076
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
35464021 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35464076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 37557192 - 37557137
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
37557192 |
taaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgtaa |
37557137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 38054549 - 38054604
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38054604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 42824088 - 42824033
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| || |||||| ||||||||||||||| |
|
|
| T |
42824088 |
taaaatatggttttggtccctgcaaatatgtcttgttttgattttagtccttgtaa |
42824033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 47136168 - 47136113
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
47136168 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgtaa |
47136113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 51545966 - 51545911
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
51545911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 52017508 - 52017563
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
52017508 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
52017563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 52017867 - 52017812
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
52017867 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
52017812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 52442089 - 52442034
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
52442089 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaa |
52442034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 53717171 - 53717116
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
53717171 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
53717116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 54903472 - 54903417
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
54903472 |
taaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
54903417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 993 - 1046
Target Start/End: Original strand, 2034544 - 2034597
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2034597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 4211564 - 4211613
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||| |||| |
|
|
| T |
4211564 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
4211613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 5797723 - 5797678
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
5797723 |
attttggttttggtccctgactccacttttgtgatgatttgcacac |
5797678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 7642556 - 7642511
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
7642556 |
attttggttttggtccctgaccccacttttgtgatgatttgcacac |
7642511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 13530476 - 13530521
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
13530476 |
attttggttttggtccctgactccacttttgtgatgatttgcacac |
13530521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 13631596 - 13631547
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
13631596 |
taaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
13631547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 14791803 - 14791754
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
14791803 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
14791754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 15555506 - 15555555
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
15555555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 18205159 - 18205208
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
18205159 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18205208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 25424215 - 25424170
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
25424215 |
attttggttttggtccctgactccacttttgtgatgatttgcacac |
25424170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 26412581 - 26412532
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
26412581 |
taaaatatggttttggtccctgcaaatatggctcgttttggttttagtcc |
26412532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 29420534 - 29420485
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
29420534 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
29420485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 32208545 - 32208594
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
32208545 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
32208594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 35415630 - 35415581
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35415630 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35415581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 35763650 - 35763699
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35763650 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35763699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 41345856 - 41345905
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
41345856 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
41345905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 41619902 - 41619951
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
41619951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 43231091 - 43231140
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
43231091 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
43231140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 46292395 - 46292444
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||| |||| |
|
|
| T |
46292395 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
46292444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 993 - 1038
Target Start/End: Complemental strand, 47532667 - 47532622
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagt |
47532622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 51738408 - 51738359
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||| |||| |
|
|
| T |
51738408 |
taaaatatggttttggtccatgcaaatatgcctcgttttgattttggtcc |
51738359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1036
Target Start/End: Original strand, 52543425 - 52543470
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
52543425 |
taaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 14791502 - 14791550
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
14791550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 20291989 - 20292037
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
20291989 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
20292037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 22584290 - 22584338
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
22584290 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
22584338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1043
Target Start/End: Original strand, 23778967 - 23779019
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||| |||| |
|
|
| T |
23778967 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcttg |
23779019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 28448837 - 28448885
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||| |||||||| |
|
|
| T |
28448837 |
taaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 982 - 1046
Target Start/End: Original strand, 42848021 - 42848085
Alignment:
| Q |
982 |
tttaaaagataaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||| | ||||||||||||||||| | |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
42848021 |
tttaaaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaa |
42848085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 1074 - 1118
Target Start/End: Original strand, 43200067 - 43200111
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
43200067 |
attttggttttgatctctgactccacttttgtgatgatttgcaca |
43200111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 54208822 - 54208774
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
54208774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 2034852 - 2034797
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
2034852 |
taaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgtaa |
2034797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 2180223 - 2180278
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
2180223 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
2180278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 2322096 - 2322143
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| ||||||| |
|
|
| T |
2322096 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagt |
2322143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 4279332 - 4279277
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
4279332 |
taaaatatgattttagtccctgcaaatatggctcgttttggttttagtccttgtaa |
4279277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 5827658 - 5827713
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
5827658 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
5827713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 5882555 - 5882609
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
5882555 |
taaaatatggttttagtcct-gcaaatatgcctcgttttggttttagtccctgtaa |
5882609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 9445952 - 9446007
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
9445952 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
9446007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 11285506 - 11285561
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
11285506 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
11285561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 12152490 - 12152435
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||| |||| ||||| |
|
|
| T |
12152490 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgtaa |
12152435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 12791971 - 12791916
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
12791971 |
taaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgtaa |
12791916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 13479608 - 13479553
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
13479608 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13479553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 13764616 - 13764671
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||| ||||| ||||| |
|
|
| T |
13764616 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgtaa |
13764671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 14488184 - 14488129
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
14488184 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
14488129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 19321856 - 19321801
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
19321856 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaa |
19321801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 20144423 - 20144478
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||| || ||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctgtaa |
20144478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 23245592 - 23245537
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
23245592 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgtaa |
23245537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 28809014 - 28809069
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
28809014 |
taaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgtaa |
28809069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 29463910 - 29463855
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||| |||| ||||| |
|
|
| T |
29463910 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaa |
29463855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 31560692 - 31560637
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
31560692 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
31560637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 31812210 - 31812155
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||| | |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
31812210 |
taaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaa |
31812155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Original strand, 32365097 - 32365144
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
32365097 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32365144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 35119295 - 35119350
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
35119295 |
taaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgtaa |
35119350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 36050291 - 36050346
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
36050291 |
taaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgtaa |
36050346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 36054147 - 36054092
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
36054147 |
taaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
36054092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 36702003 - 36702058
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
36702003 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
36702058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 41324887 - 41324832
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
41324887 |
taaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgtaa |
41324832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 44925842 - 44925787
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
44925842 |
taaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgtaa |
44925787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 45505891 - 45505844
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
45505891 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
45505844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 52441766 - 52441821
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
52441766 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
52441821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 52543724 - 52543669
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
52543724 |
taaaatatgattttggttcttgcaaatatgcctcgttttggttttaatccatgtaa |
52543669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 53308065 - 53308010
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| | ||||||| ||||||||| ||||| |
|
|
| T |
53308065 |
taaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgtaa |
53308010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 53716924 - 53716979
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| || |||||| ||||||||||||||| |
|
|
| T |
53716924 |
taaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgtaa |
53716979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 53916044 - 53915997
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||| |
|
|
| T |
53916044 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
53915997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 55072392 - 55072447
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
55072392 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
55072447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 55072709 - 55072654
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
55072654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 991 - 1029
Target Start/End: Original strand, 5202929 - 5202967
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgtttt |
1029 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttt |
5202967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 123537 - 123586
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
123537 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
123586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1075 - 1116
Target Start/End: Original strand, 5827753 - 5827794
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgca |
1116 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
5827753 |
ttttggttttggtccctgaccccacttttgtgatgatttgca |
5827794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 6827871 - 6827822
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
6827871 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
6827822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1036
Target Start/End: Original strand, 8904889 - 8904934
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
8904889 |
taaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 9289269 - 9289318
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
9289269 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
9289318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 11692765 - 11692814
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
11692765 |
taaaatgtggttttggtccctgcaaatatgccccgttttgattttagtcc |
11692814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 13530382 - 13530431
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
13530382 |
taaaatatggttttgctccctgcaaatatgtctcgttttgattttagtcc |
13530431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 14488090 - 14488045
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
14488090 |
attttggttttggtccctgacaccaattttgtgatgatttgcacac |
14488045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 20144728 - 20144683
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
20144728 |
taaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 23245328 - 23245373
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||| |
|
|
| T |
23245328 |
attttggttttggtccctgactccacttttgtgataatttgcacac |
23245373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 24474960 - 24474911
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
24474960 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
24474911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 24774330 - 24774285
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
24774330 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
24774285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 26412193 - 26412242
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
26412193 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtcc |
26412242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 26412487 - 26412442
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||| |
|
|
| T |
26412487 |
attttggttttggtccctgactccacttttgtgataatttgcacac |
26412442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 27008087 - 27008136
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
27008087 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
27008136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 993 - 1046
Target Start/End: Complemental strand, 27008401 - 27008348
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
27008348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 28809177 - 28809128
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
28809177 |
taaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
28809128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 31182222 - 31182267
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
31182222 |
attttggttttgatctctgaccccacttttgtaatgatttgcacac |
31182267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 31560334 - 31560383
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
31560334 |
taaaatatggttttgatccctgcaaatatgcttcgttttggttttagtcc |
31560383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 32208898 - 32208849
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
32208898 |
taaaatatggttttaatccctgcaaatatgcctcgttttgattttagtcc |
32208849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 32365480 - 32365431
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
32365480 |
taaaatatggttttagtccctgcaaatatggctcgttttggttttagtcc |
32365431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 42848294 - 42848249
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||| |
|
|
| T |
42848294 |
attttggttttggtccctgactccacttttgtgataatttgcacac |
42848249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 45505603 - 45505652
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
45505603 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
45505652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 46088057 - 46088008
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
46088057 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
46088008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 46115682 - 46115637
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
46115682 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
46115637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 46128816 - 46128771
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
46128816 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
46128771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 47135875 - 47135920
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
47135875 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
47135920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 50714243 - 50714292
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
50714243 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
50714292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 50714562 - 50714513
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
50714562 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
50714513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 51763105 - 51763060
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
51763105 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
51763060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 54208728 - 54208683
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
54208728 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
54208683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 55805085 - 55805036
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| |||||| ||||||||| |
|
|
| T |
55805085 |
taaaatatagttttggttcttgcaaatatgccttgttttggttttagtcc |
55805036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 4211599 - 4211643
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
4211599 |
ttttggttttggtccctggccccacttttgtgatgatttgcacac |
4211643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 12791876 - 12791832
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
12791876 |
ttttggttttggtccctgacctcacttttgtgatgatttgcacac |
12791832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 14791768 - 14791724
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
14791768 |
ttttggttttagtccctgaccccacttttgtgatgatttgcacac |
14791724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 22099909 - 22099861
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| |||||||| |
|
|
| T |
22099909 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
22099861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 36050384 - 36050428
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
36050384 |
ttttggttttggtccctggccccacttttgtgatgatttgcacac |
36050428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1043
Target Start/End: Complemental strand, 41346215 - 41346163
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||| ||||| |||||||||||| |
|
|
| T |
41346215 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttg |
41346163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 983 - 1046
Target Start/End: Original strand, 43368459 - 43368523
Alignment:
| Q |
983 |
ttaaaaga-taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| |||||||||||||| |||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
43368459 |
ttaaaagactaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
43368523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 44925488 - 44925536
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| |||||||| |
|
|
| T |
44925488 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 46292430 - 46292474
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
46292430 |
ttttggttttggtccctgcccccacttttgtgatgatttgcacac |
46292474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 46292648 - 46292600
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||| |||||||| |
|
|
| T |
46292648 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
46292600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 51545632 - 51545680
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| ||||||||| |||||||||| |||||||| |
|
|
| T |
51545632 |
taaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
51545680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 51708696 - 51708744
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| |||||||| |
|
|
| T |
51708696 |
taaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
51708744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 51709024 - 51708976
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||| |||||||| |
|
|
| T |
51709024 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
51708976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Complemental strand, 51738373 - 51738329
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
51738373 |
ttttgattttggtccctgactccacttttgtgatgatttgcacac |
51738329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 993 - 1040
Target Start/End: Complemental strand, 123893 - 123846
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
123846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 2180569 - 2180514
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||| ||||| |||| |||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
2180569 |
taaaatatagttttagtccctgcaaatatggcacgttttggttttagtccttgtaa |
2180514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 2322429 - 2322382
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||||| |
|
|
| T |
2322429 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagt |
2322382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 8191388 - 8191333
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| | ||| ||||| ||||| |
|
|
| T |
8191388 |
taaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgtaa |
8191333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 993 - 1040
Target Start/End: Complemental strand, 9289634 - 9289587
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
9289634 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
9289587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 12152157 - 12152212
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
12152157 |
taaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgtaa |
12152212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 13764804 - 13764749
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||| ||||||||| ||||| |
|
|
| T |
13764804 |
taaaatatggttttggtccctgtaaatatgtttcgttttggttttagtccatgtaa |
13764749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 18205520 - 18205473
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||| |
|
|
| T |
18205520 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
18205473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 24474603 - 24474657
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
24474603 |
taaaatatggttttagtcct-gcaaatatgcatcgttttggttttagtccatgtaa |
24474657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 1075 - 1118
Target Start/End: Original strand, 26314088 - 26314131
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
26314088 |
ttttggttttggtccatgactccacttttgtgatgatttgcaca |
26314131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 26314329 - 26314274
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| || ||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
26314329 |
taaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgtaa |
26314274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 31811928 - 31811983
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
31811928 |
taaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgtaa |
31811983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 36702360 - 36702305
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| || | |||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
36702360 |
taaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgtaa |
36702305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 37556844 - 37556899
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| | |||||||||||| ||||| |||| ||||||||| ||||| |
|
|
| T |
37556844 |
taaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgtaa |
37556899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 51738140 - 51738195
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| | |||||||| ||||||||| ||||| ||| ||||| |
|
|
| T |
51738140 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgtaa |
51738195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1038
Target Start/End: Complemental strand, 51763199 - 51763152
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagt |
1038 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
51763199 |
taaaatatagttttggtccctgcaaatatgcctcattttggttttagt |
51763152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 52430097 - 52430042
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
52430097 |
taaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaa |
52430042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 55482465 - 55482410
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| | |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
55482465 |
taaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgtaa |
55482410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 1075 - 1117
Target Start/End: Complemental strand, 12152395 - 12152353
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcac |
1117 |
Q |
| |
|
||||||||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
12152395 |
ttttggttttggtctctgaccccacttttgtgatgatttgcac |
12152353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1041
Target Start/End: Original strand, 14594209 - 14594259
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcct |
1041 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| |||| |||||||||| |
|
|
| T |
14594209 |
taaaatatggttttggtccctgcaaatatgtctcactttggttttagtcct |
14594259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1045
Target Start/End: Original strand, 35420394 - 35420448
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgta |
1045 |
Q |
| |
|
||||||||||||||||||| |||||||||| | |||||| ||||||||| |||| |
|
|
| T |
35420394 |
taaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctgta |
35420448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 1073 - 1119
Target Start/End: Complemental strand, 44925747 - 44925701
Alignment:
| Q |
1073 |
aattttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||||| || || |||||||||||||||||||||||||| |
|
|
| T |
44925747 |
aattttggttttggtctatggcgccacttttgtgatgatttgcacac |
44925701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 1075 - 1113
Target Start/End: Complemental strand, 50754157 - 50754119
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgattt |
1113 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
50754157 |
ttttggttttggtccctgaccccacttttgtgatgattt |
50754119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 5797817 - 5797772
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
||||||||||||||||||| | |||||||| ||||||||| ||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggtttta |
5797772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 8905231 - 8905186
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||| ||||| |
|
|
| T |
8905231 |
taaaatatggttttggtccctgtaaatatgcctcattttgatttta |
8905186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1036
Target Start/End: Original strand, 13479275 - 13479320
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||| |
|
|
| T |
13479275 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 13631502 - 13631457
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
||||||||||||||| ||| | ||||||||||||| |||||||||| |
|
|
| T |
13631502 |
attttggttttgatcactggctccacttttgtgataatttgcacac |
13631457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1087 - 1116
Target Start/End: Complemental strand, 16712584 - 16712555
Alignment:
| Q |
1087 |
tccctgacgccacttttgtgatgatttgca |
1116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16712584 |
tccctgacgccacttttgtgatgatttgca |
16712555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 19321573 - 19321622
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| ||||||||| || ||| ||||||||||||| ||||||||| |
|
|
| T |
19321573 |
taaaatatgattttggtccctgtaaacatgcctcgttttggttttagtcc |
19321622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 19321667 - 19321712
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| | |||||| ||||||||||||| |||||||||| |
|
|
| T |
19321667 |
attttggttttggttcctgactccacttttgtgataatttgcacac |
19321712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 31560428 - 31560473
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| ||||| |||| |
|
|
| T |
31560428 |
attttggttttggtccctgactccacttttgtgataatttgtacac |
31560473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 31812020 - 31812065
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||| ||||||||||||||| |
|
|
| T |
31812020 |
attttggttttggtccctggctccacttttatgatgatttgcacac |
31812065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 35119608 - 35119559
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| ||| ||||| |
|
|
| T |
35119608 |
taaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 35415302 - 35415351
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| || |||||||| |||||||| ||||||||| |
|
|
| T |
35415302 |
taaaatatggttttagtccctgtaaatatgcatcgttttggttttagtcc |
35415351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 35464285 - 35464240
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
35464285 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
35464240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 35763952 - 35763903
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| |||| |||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
35763952 |
taaaatatgattttagtccctgcagatatgcctcgttttggttttagtcc |
35763903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 41620253 - 41620204
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| || |||||||| |||||||| ||||||||| |
|
|
| T |
41620253 |
taaaatatggttttagtccctgtaaatatgcatcgttttggttttagtcc |
41620204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 46115776 - 46115727
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||| | ||||||||| ||||||||| |
|
|
| T |
46115776 |
taaaatatggttttagtccctgcaaatacgtctcgttttggttttagtcc |
46115727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 46128910 - 46128861
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||| | ||||||||| ||||||||| |
|
|
| T |
46128910 |
taaaatatggttttagtccctgcaaatacgtctcgttttggttttagtcc |
46128861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Complemental strand, 47023008 - 47022963
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||| ||||||||||||||| |
|
|
| T |
47023008 |
attttggttttggtccctggctccacttttttgatgatttgcacac |
47022963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 47023102 - 47023053
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||| ||||||||| |
|
|
| T |
47023102 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcc |
47023053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 53915780 - 53915825
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
53915780 |
attttggttttggtccctggctccacttttgtgataatttgcacac |
53915825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 44; Significance: 0.000000000000002; HSPs: 5)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 54818 - 54873
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
54818 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
54873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 50075 - 50026
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
50026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 55176 - 55127
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
55127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #4
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 1074 - 1117
Target Start/End: Complemental strand, 49981 - 49938
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcac |
1117 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
49981 |
attttggttttggtccctgactccacttttgtgataatttgcac |
49938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #5
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 1074 - 1117
Target Start/End: Complemental strand, 55082 - 55039
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcac |
1117 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
55082 |
attttggttttggtccctgactccacttttgtgataatttgcac |
55039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 44; Significance: 0.000000000000002; HSPs: 3)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 82703 - 82648
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
82703 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
82648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 82344 - 82393
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||| | ||||||||| ||||||||| |
|
|
| T |
82344 |
taaaatatggttttggtccctgcaaatacgtctcgttttggttttagtcc |
82393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #3
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 82438 - 82483
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
82438 |
attttggttttggtccctggctccacttttgtgatgatttgcacac |
82483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 42; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 75761 - 75712
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
75761 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
75712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 75362 - 75417
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
75362 |
taaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaa |
75417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 2781 - 2836
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
2781 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 8735 - 8790
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
8735 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
8790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 9025 - 8970
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
9025 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
8970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 4309 - 4254
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
4309 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttgtaa |
4254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 995 - 1040
Target Start/End: Original strand, 4016 - 4061
Alignment:
| Q |
995 |
atatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||| |||| | |||||||||||||||||| ||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtcc |
4061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 12528 - 12583
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
12528 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
12583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 22052 - 21997
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| | ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
22052 |
taaaatatggttttggtcccttcaaatttgcctcgttttggttttagtccttgtaa |
21997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 27361 - 27306
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
27361 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
27306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 993 - 1046
Target Start/End: Original strand, 27005 - 27057
Alignment:
| Q |
993 |
aaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||| |||||||||||| |||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
27005 |
aaatttggttttggtccctgcaaatatgtctcgttttg-ttttaatccttgtaa |
27057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 3535 - 3590
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
3535 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
3590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 3915 - 3860
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
3915 |
taaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
3860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 8333 - 8388
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
8333 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
8388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 8639 - 8584
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
8639 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
8584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 12533 - 12478
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12533 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
12478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 12185 - 12240
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
12185 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaa |
12240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 365982 - 366037
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
365982 |
taaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgtaa |
366037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 366270 - 366215
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
366270 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
366215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 148279 - 148224
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
148279 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
148224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 147984 - 148029
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
147984 |
attttggttttggtccctggcttcacttttgtgatgatttgcacac |
148029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 38; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 2657 - 2608
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
2657 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
2608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 38; Significance: 0.000000000007; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 14700 - 14749
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
14700 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
14749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 15009 - 14954
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
15009 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgtaa |
14954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 38; Significance: 0.000000000007; HSPs: 4)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 47928 - 47977
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
47928 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
47977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1039
Target Start/End: Complemental strand, 48228 - 48180
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
48180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 1075 - 1119
Target Start/End: Original strand, 47963 - 48007
Alignment:
| Q |
1075 |
ttttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
47963 |
ttttggttttagtccctgaccccacttttgtgatgatttgcacac |
48007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 991 - 1041
Target Start/End: Complemental strand, 223169 - 223119
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcct |
1041 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| |||| |||||||||| |
|
|
| T |
223169 |
taaaatatggttttggtccctgcaaatatgtctcactttggttttagtcct |
223119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 37; Significance: 0.00000000003; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1043
Target Start/End: Original strand, 4044 - 4096
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
4044 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
4096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 991 - 1043
Target Start/End: Original strand, 19226 - 19278
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
19226 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
19278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1043
Target Start/End: Complemental strand, 4285 - 4233
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
4285 |
taaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttg |
4233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1043
Target Start/End: Complemental strand, 19467 - 19415
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttg |
1043 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
19467 |
taaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttg |
19415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 37; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 1074 - 1118
Target Start/End: Original strand, 16820 - 16864
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcaca |
1118 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
16820 |
attttggttttggtccctgactccacttttgtgatgatttgcaca |
16864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 36; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 5212 - 5267
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
5212 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaa |
5267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 36; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 5232 - 5287
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
5232 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaa |
5287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 35; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 991 - 1041
Target Start/End: Original strand, 10171 - 10221
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcct |
1041 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
10171 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagtcct |
10221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 34; Significance: 0.000000002; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 1314 - 1363
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
1314 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
1363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 1641 - 1592
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| ||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
1641 |
taaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtcc |
1592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 34; Significance: 0.000000002; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 8550 - 8599
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
8550 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
8599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 34; Significance: 0.000000002; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 286 - 237
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
286 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 34; Significance: 0.000000002; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 34934 - 34983
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||| || |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
34934 |
taaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtcc |
34983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 34; Significance: 0.000000002; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 1074 - 1119
Target Start/End: Original strand, 189425 - 189470
Alignment:
| Q |
1074 |
attttggttttgatccctgacgccacttttgtgatgatttgcacac |
1119 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
189425 |
attttggttttggtccctggccccacttttgtgatgatttgcacac |
189470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 34; Significance: 0.000000002; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 2504 - 2553
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
2504 |
taaaatatggttttgatccctgcaaatatgcttcgttttgattttagtcc |
2553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 2880 - 2831
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
2880 |
taaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtcc |
2831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 33; Significance: 0.000000007; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 991 - 1039
Target Start/End: Original strand, 5402 - 5450
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtc |
1039 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||| |||||||| |
|
|
| T |
5402 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
5450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Complemental strand, 5705 - 5656
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| |||| |||||||||| || |||||| ||||||||| |
|
|
| T |
5705 |
taaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
5656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 32; Significance: 0.00000003; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 3288 - 3233
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
3288 |
taaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaa |
3233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 32; Significance: 0.00000003; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 18040 - 17985
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
18040 |
taaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgtaa |
17985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 32; Significance: 0.00000003; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 17963 - 17908
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| | ||| ||||| ||||| |
|
|
| T |
17963 |
taaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgtaa |
17908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 32; Significance: 0.00000003; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Complemental strand, 35081 - 35026
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||| ||| | |||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
35081 |
taaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgtaa |
35026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 32; Significance: 0.00000003; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 3755 - 3810
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
||||||||||||||||||| ||||||||||| | |||||| ||||| ||| ||||| |
|
|
| T |
3755 |
taaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctgtaa |
3810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 32; Significance: 0.00000003; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 991 - 1046
Target Start/End: Original strand, 94060 - 94115
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtccttgtaa |
1046 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
94060 |
taaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgtaa |
94115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1036
Target Start/End: Complemental strand, 94327 - 94282
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgctttta |
1036 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||| ||||| |
|
|
| T |
94327 |
taaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 991 - 1040
Target Start/End: Original strand, 24375 - 24424
Alignment:
| Q |
991 |
taaaatatggttttggtccttgcaaatatgcctcgttttgcttttagtcc |
1040 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
24375 |
taaaatatggttttagtcactgcaaatatgtctcgttttggttttagtcc |
24424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University