View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3743_low_39 (Length: 254)
Name: NF3743_low_39
Description: NF3743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3743_low_39 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 10 - 254
Target Start/End: Complemental strand, 31877476 - 31877230
Alignment:
| Q |
10 |
agtgagatgaatccattcataagaataaagtatttgtctcttcacttttccatttcttcactggaaaatgatgattttagtattaaacatgannnnnnna |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
31877476 |
agtgaaatgaatccattcataagaataaagtatttgtctcttcacttttccatttcttcactggaaaatgatgattttagttttaaacatgattttttta |
31877377 |
T |
 |
| Q |
110 |
tattgtaaacatagtttgg-tttgattcctgtaaataatttctacggttttcatctct-ttaaaagtttaaatattatttttgatctctatcattatgac |
207 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31877376 |
tattgtaaacatagtttggttttgattcctgtaaatactttctacggttttcatctctatcaaaagtttaaatattatttttgatctctatcattatgac |
31877277 |
T |
 |
| Q |
208 |
gttttcactaatatctcatgtgtttaacgaaaggtcgtgtaatatct |
254 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31877276 |
gttttcattaatatctcatgtgtttaacgaaaggtcgtgtaatatct |
31877230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University