View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3743_low_47 (Length: 242)

Name: NF3743_low_47
Description: NF3743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3743_low_47
NF3743_low_47
[»] chr2 (2 HSPs)
chr2 (57-226)||(33772495-33772650)
chr2 (18-59)||(33772436-33772477)


Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 57 - 226
Target Start/End: Original strand, 33772495 - 33772650
Alignment:
57 gaagttcttagttttcccaagcatgactcaatgtgcccaacaaacaactaagctttttagttgggatttagctgtataccgcattttgtgcacaaaaatt 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33772495 gaagttcttagttttcccaagcatgactcaatgtgcccaacaaacaactaagctttttagttgggatttagctgtataccgcattttgtgcacaaaaatt 33772594  T
157 ggtctatgctagacaagagattagatagatatgatatgtggaatggaagctgattctcctccattgtatt 226  Q
    |||||              |||||||||||||||||||||||||||||||||||||||||||||||||||    
33772595 ggtct--------------attagatagatatgatatgtggaatggaagctgattctcctccattgtatt 33772650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 33772436 - 33772477
Alignment:
18 catggaatgatgggtgggtggcagtggattggatccaaagaa 59  Q
    ||||||||||||||| ||||||||||| ||||||||||||||    
33772436 catggaatgatgggtaggtggcagtgggttggatccaaagaa 33772477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University