View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3743_low_47 (Length: 242)
Name: NF3743_low_47
Description: NF3743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3743_low_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 57 - 226
Target Start/End: Original strand, 33772495 - 33772650
Alignment:
| Q |
57 |
gaagttcttagttttcccaagcatgactcaatgtgcccaacaaacaactaagctttttagttgggatttagctgtataccgcattttgtgcacaaaaatt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33772495 |
gaagttcttagttttcccaagcatgactcaatgtgcccaacaaacaactaagctttttagttgggatttagctgtataccgcattttgtgcacaaaaatt |
33772594 |
T |
 |
| Q |
157 |
ggtctatgctagacaagagattagatagatatgatatgtggaatggaagctgattctcctccattgtatt |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33772595 |
ggtct--------------attagatagatatgatatgtggaatggaagctgattctcctccattgtatt |
33772650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 33772436 - 33772477
Alignment:
| Q |
18 |
catggaatgatgggtgggtggcagtggattggatccaaagaa |
59 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
33772436 |
catggaatgatgggtaggtggcagtgggttggatccaaagaa |
33772477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University