View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3743_low_52 (Length: 238)
Name: NF3743_low_52
Description: NF3743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3743_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 17 - 174
Target Start/End: Complemental strand, 28976530 - 28976372
Alignment:
| Q |
17 |
acctagatggttaaattcctagtttcatgtagtttaaccatcttgtttttatcatccaagggatgagggtgctatttttcgaagcagcagccaccaaaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28976530 |
acctagatggttaaattcctagtttcatgtagtttaaccatcttgtttttatcatccaagggatgagggtgctatttttcgaagcagcagccaccaaaga |
28976431 |
T |
 |
| Q |
117 |
tgaatcatgttcaaag-nnnnnnnttacatatgcattttcaaaaagaaattttgatagc |
174 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28976430 |
tgaatcatgttcaaagaaaaaaaattacatatgcattttcaaaaagaaattttgatagc |
28976372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 29 - 128
Target Start/End: Original strand, 34860659 - 34860759
Alignment:
| Q |
29 |
aaattcct-agtttcatgtagtttaaccatcttgtttttatcatccaagggatgagggtgctatttttcgaagcagcagccaccaaagatgaatcatgtt |
127 |
Q |
| |
|
|||||||| ||||||| |||||||| |||||| ||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34860659 |
aaattcctgagtttcaagtagtttagccatctagtttttatctttcaagggatgagggtgctattttacgaagcagcagccaccaaagatgaatcatgtt |
34860758 |
T |
 |
| Q |
128 |
c |
128 |
Q |
| |
|
| |
|
|
| T |
34860759 |
c |
34860759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University