View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3743_low_55 (Length: 233)
Name: NF3743_low_55
Description: NF3743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3743_low_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 6 - 219
Target Start/End: Original strand, 19577174 - 19577387
Alignment:
| Q |
6 |
cccacaagccactcttcagttataagtagaattagggaatctaaacataatgaaaacagagaaaacaccctctttagaaaacattcagattcaagagcaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19577174 |
cccacaagccactcttcagttataagtagaattagggaatctaaacataatgaaaacagagaaaacaccctctttagaaaacattcagattcaagagcaa |
19577273 |
T |
 |
| Q |
106 |
acacaggtacctgcaaaaagtcatacaggtcattgctaacacccttttcattatgacgaatatcacgtaaatcagtactgtagctaaatccagttccagt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19577274 |
acacaggtacctgcaaaaagtcatacaggtcattgctaacacccttttcattatgacgaatatcacgtaaatcagtactgtagctaaagccagttccagt |
19577373 |
T |
 |
| Q |
206 |
aggttgatcaacat |
219 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19577374 |
aggttgatcaacat |
19577387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 112 - 219
Target Start/End: Complemental strand, 42336511 - 42336404
Alignment:
| Q |
112 |
gtacctgcaaaaagtcatacaggtcattgctaacacccttttcattatgacgaatatcacgtaaatcagtactgtagctaaatccagttccagtaggttg |
211 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| ||||| | ||||| ||||||||||||||| ||| ||| |||| || || ||||||||||| ||||| |
|
|
| T |
42336511 |
gtacctgtaaaaagtcatagaggtcattgctgacaccatcttcatcatgacgaatatcacgcttatcggtagtgtaactgaagccagttccagttggttg |
42336412 |
T |
 |
| Q |
212 |
atcaacat |
219 |
Q |
| |
|
||||||| |
|
|
| T |
42336411 |
gtcaacat |
42336404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University