View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3745_high_14 (Length: 291)
Name: NF3745_high_14
Description: NF3745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3745_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 22 - 272
Target Start/End: Original strand, 4405493 - 4405734
Alignment:
| Q |
22 |
acaacaacagaatcaaaacattgtttctacaggtttaggtttatcctttggtgatcaacaacatcaaagactacaattgctnnnnnnnnnnnnnnnnnnt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4405493 |
acaacaacagaatcaaaacattgtttctacaggtttaggtttatcctttggtgatcaacaacatcaaagactacaattgctacaacaacaaca------- |
4405585 |
T |
|
| Q |
122 |
gggtgtcattcctctcatttcttgtctctattgtcaaatggtttagcttcacaaatcaaacaacaaaaggatgaaattgaccaattccttcaagcccagg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4405586 |
--gtgtcattcctctcatttcttgtctctattgtcaaatggtttagcttcacaaatcaaacaacaaaaagatgaaattgaccaattccttcaagcccagg |
4405683 |
T |
|
| Q |
222 |
tacaattcttccatatgttaacaatttctggattagtaggtcattgaaatg |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4405684 |
tacaattcttccatatgttaacaatttctggattagtgggtcattgaaatg |
4405734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University