View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3745_high_8 (Length: 396)
Name: NF3745_high_8
Description: NF3745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3745_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 3e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 18 - 259
Target Start/End: Original strand, 3403948 - 3404160
Alignment:
| Q |
18 |
agctattagttgagggaatcaagtaatagtttgccgctagagatgagtatgaagtccaacatgtttaagcagttcaaacgtcattttggtacccatgcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3403948 |
agctattagttgagggaatcaagtaatagtttgccgctagagatgagtatgaagtccaacatgtttaagcagttcaaacgtcattttggt---------- |
3404037 |
T |
|
| Q |
118 |
ttggacccagggctgcaagcctagtatcattggtttatgggttataagtttgtgacgtgaagttcaatcttatgcattgttttttattgaattgccttag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
3404038 |
----acccagggctgcaagcctagtatcattgatttatgggttatatgtttgtgacgtgaagttcaatcttaggc---------------attgccttag |
3404118 |
T |
|
| Q |
218 |
aatatcttatgggaagtggatggaggtaaacatatagtcgtt |
259 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
3404119 |
aatatcttattggcagtggatggaggtaaacatatagtcgtt |
3404160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 288 - 393
Target Start/End: Original strand, 3404159 - 3404264
Alignment:
| Q |
288 |
ttcaagcatgcatgatgtgacatgtctcgatggacaattgtaactaatggttgcatttgagtggtgttcgttcagtccagacgcaacgttcatgattgtt |
387 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3404159 |
ttcaagcatgcatgatgtgacaggtcttgatggaaaattgtaactaatggttgcattttagtggtgttcgttcagtccagacgcaacgttcatgattttt |
3404258 |
T |
|
| Q |
388 |
ggattc |
393 |
Q |
| |
|
|||||| |
|
|
| T |
3404259 |
ggattc |
3404264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University