View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3745_low_19 (Length: 227)
Name: NF3745_low_19
Description: NF3745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3745_low_19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 39356254 - 39356035
Alignment:
| Q |
7 |
gattactcatttaaaatttaaaattgacacttaattagtttttaatttgaggctgtatgtgagtgtgtatgannnnnnnnnnnnnnnnnnctgaaatcga |
106 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39356254 |
gattactcatttataatttcaaattgacacttaattagtttttaatttgaggctgtatgtgagtgtgtatgattttcttttttcttttttctgaaatcga |
39356155 |
T |
 |
| Q |
107 |
ttactttaatgttttttggaaatcaattattcattcgcacgtgtgtctattatattaagtagatatagcannnnnnnattaaacttccttcaacaacaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39356154 |
ttactttaatgttttttggaaatcaattattcattcgcacgtgtgtctattatattaagtagatatagca-ttttttattaaacttccttcaacaacaaa |
39356056 |
T |
 |
| Q |
207 |
aaccaattttctatcccttca |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39356055 |
aaccaattttctatcccttca |
39356035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University