View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3745_low_3 (Length: 555)
Name: NF3745_low_3
Description: NF3745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3745_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 3e-49; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 408 - 547
Target Start/End: Complemental strand, 10469281 - 10469142
Alignment:
| Q |
408 |
gtggtggtggttacattgtagggggatgttaattccgggtgaaatcgctgctgaatcatacaaaaaagcagttgaatcagcgattcagaaactgagagat |
507 |
Q |
| |
|
|||| ||||||| |||||||| || | |||||||||| ||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10469281 |
gtggcggtggttgcattgtagtggaaagttaattccgagtggaatcgctgatgactcatacaaaaaagcagttgaatcagcgattcagaaactgagagat |
10469182 |
T |
|
| Q |
508 |
gaggaagtagaagaagatgatgaagaagccaatgatgatg |
547 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10469181 |
gaggaagttgaagaagatgatgaagaagccaatgatgatg |
10469142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 106 - 173
Target Start/End: Complemental strand, 10469669 - 10469602
Alignment:
| Q |
106 |
gctgaaacgacgtcgtgtggttctttgctctgttttatgattttatatcggaaagtagctgcagcacc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10469669 |
gctgaaacgacgtcgtgtggttctttgctctgttttatgattttatatcggaaagtagctgcagcacc |
10469602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 196 - 306
Target Start/End: Complemental strand, 10469484 - 10469383
Alignment:
| Q |
196 |
gacattttctatttgagtcttgtggttgtgtatgtgttatccgtgctttctattgcactgataacagagaaatttcttttaacagccaaaatttgtaata |
295 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
10469484 |
gacattttctatttgagtcttgtg------tatgtgtta---gtgctttctattgcacggataacagattaatttcttttaacagccaaaatttctaata |
10469394 |
T |
|
| Q |
296 |
aaataaatacg |
306 |
Q |
| |
|
||||||||||| |
|
|
| T |
10469393 |
aaataaatacg |
10469383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 16 - 49
Target Start/End: Complemental strand, 10469762 - 10469729
Alignment:
| Q |
16 |
attccaacgaacgaaattcaaaatccacaaatag |
49 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
10469762 |
attccaacgaacgaaattcaaaatctacaaatag |
10469729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University