View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3746_high_4 (Length: 287)
Name: NF3746_high_4
Description: NF3746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3746_high_4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 287
Target Start/End: Complemental strand, 43528494 - 43528223
Alignment:
| Q |
18 |
ggattcaggtttgtggagttcttcttcaaagaccaaaatcagaacgcctttcccagaacgctttctccaccgaaagaattcttctcaggataacgtaagc |
117 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43528494 |
ggattcgggttcgtggagttcttcttcaaagaccaaaatcagaacgcctttcccagaacgctttctccaccgaaataattcttctcaggataacgtaagc |
43528395 |
T |
 |
| Q |
118 |
ccctaatttctcatctgtagggttttcttaaatttaggctttctcattttattttatcgattcagatactctcaatttatg--nnnnnnnnngtcaacaa |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43528394 |
ccctaatttctcatctgtagggctttcttaaatttaggctttctcattttattttatcgattcagatactctcaatttatgtttttttttttgtcaacaa |
43528295 |
T |
 |
| Q |
216 |
tttagggttttctctaatttctcaatttagggttttagtgtttcacaatttcttttccattcgatttttacc |
287 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43528294 |
tttagggttttctctaatatctcaatttagggttttagtgtttcacaatttcttttccgttcgatttttacc |
43528223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University