View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3747_low_4 (Length: 335)
Name: NF3747_low_4
Description: NF3747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3747_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 19 - 320
Target Start/End: Complemental strand, 9781073 - 9780772
Alignment:
| Q |
19 |
ttggtgttgtgcattgttgttgcacatattgcagaagctgatagatttggctacattatttatactcttactccatgctatccttttcttctaggttcaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9781073 |
ttggtgttgtgcattgttgttgcacatattgcagaagctgatagatttgccttcattatttatactcttactccatgctatccttttcttataggttcaa |
9780974 |
T |
|
| Q |
119 |
tttcagttgctacgccacattgttgtgaagcagtgaaggaagttgatgatgacgccaaagactatgatgatcgtctagaaacttgtgactgcttgaaaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9780973 |
tttcagttgctacgccacattgttgtgaagcagtgaaggaagttgatgatgacgccaaagactatgatgatcgtctagaaacttgtgactgcttgagaga |
9780874 |
T |
|
| Q |
219 |
tatggctctttcttttaagaaggatttcaatgttgaaaatggtgctgcactctttgccttatgtggtattcaaacaccctaccagatttctcgtgatatc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9780873 |
tatggctctttcttttaagaaggatttcaatgttgaaaatggtgctgcactctttgccttatgtggtattcaaacaccctaccagatttctcgagatatc |
9780774 |
T |
|
| Q |
319 |
aa |
320 |
Q |
| |
|
|| |
|
|
| T |
9780773 |
aa |
9780772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University