View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3749_high_12 (Length: 261)
Name: NF3749_high_12
Description: NF3749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3749_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 10 - 242
Target Start/End: Original strand, 42216870 - 42217102
Alignment:
| Q |
10 |
gacatcatcagcaatggcctcatcaaagccagcaagcatgtccatgtcactgcacccaatggtccaacaaactttatacattgcaatacgtgctgatggg |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42216870 |
gacaccatcagcaatggcctcatcaaagccagcaagcatgtccatgtcactgcacccaatggtccaacaaactttatacattgcaatgcgtgctgatggg |
42216969 |
T |
|
| Q |
110 |
acaccgccacgggcattgcctttaccaatgccataaagacttgcacccctcaccactgatccagccgctgtcgacgaagtgtgagtgccatggccctgat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42216970 |
acaccgccacgggcattgcctttaccaatgccataaagacttgcacctctcaccactgatccagctgctgtcgacgaagtgtgagtgccatggccctgat |
42217069 |
T |
|
| Q |
210 |
catcaaccggacttgggttctcgatggttggac |
242 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
42217070 |
catccaccggacttgggttctcgatggttggac |
42217102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University