View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3751_high_11 (Length: 250)
Name: NF3751_high_11
Description: NF3751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3751_high_11 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 77 - 250
Target Start/End: Original strand, 32349855 - 32350028
Alignment:
| Q |
77 |
caaagattgttttgtttcgttaacttcgtcttaaacaacattcttcagtgattcaaacttgagagtgttctatgaacttccttcaggaagtacctagaat |
176 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32349855 |
caaagattgttttgtttcgttaacttggtctcaaacaacattcttcagtgattcaaacttgagagtgttctatgaacttccttcaggaagtacctagaat |
32349954 |
T |
|
| Q |
177 |
taacaactgcattggtagaagaggcacatgcaaaagcagcaagagatgaagttgatgaatttttaggtggtgaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32349955 |
taacaactgcattggtagaagaggcacatgcagaagcagcaagagatgaagttgatgaatttttaggtggtgaa |
32350028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 119 - 202
Target Start/End: Original strand, 32342774 - 32342857
Alignment:
| Q |
119 |
cttcagtgattcaaacttgagagtgttctatgaacttccttcaggaagtacctagaattaacaactgcattggtagaagaggca |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||| ||||||||||||||||||| |
|
|
| T |
32342774 |
cttcagtgattcaaacttgagagtgttctatgaacttccttcaggaagtccctggtgttaacagttgcattggtagaagaggca |
32342857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 41 - 80
Target Start/End: Original strand, 32349796 - 32349835
Alignment:
| Q |
41 |
gatatcaatacataaaagataagagaagaagaacaacaaa |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32349796 |
gatatcaatacataaaagataagagaagaagaagaacaaa |
32349835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 207
Target Start/End: Complemental strand, 33139422 - 33139343
Alignment:
| Q |
128 |
ttcaaacttgagagtgttctatgaacttccttcaggaagtacctagaattaacaactgcattggtagaagaggcacatgc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
33139422 |
ttcaaacttgagagtgttctatgaacttcattcaaaaagtacctagtattaactcttgcattggtagaagaggcacatgc |
33139343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 198
Target Start/End: Complemental strand, 33143104 - 33143035
Alignment:
| Q |
129 |
tcaaacttgagagtgttctatgaacttccttcaggaagtacctagaattaacaactgcattggtagaaga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||| |||| ||||||||||||||| |
|
|
| T |
33143104 |
tcaaacttgagagtgttctatgaacttcattcagaaagtacctagtgttaattgttgcattggtagaaga |
33143035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University