View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3751_low_13 (Length: 233)

Name: NF3751_low_13
Description: NF3751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3751_low_13
NF3751_low_13
[»] chr8 (1 HSPs)
chr8 (27-217)||(941357-941547)


Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 27 - 217
Target Start/End: Complemental strand, 941547 - 941357
Alignment:
27 tatatgcattatctattttttgatattagagtatnnnnnnnnntatggaattaatgaaatacagtcaataacaagaaagtacaaattaacttacagcata 126  Q
    ||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
941547 tatatgcattatctattttttgatattagagtataaaaaaaaaaatggaattaatgaaatacagtcaataacaagaaagtacaaattaacttacagcata 941448  T
127 atcaagctcttcaaagttatagtttttgccagactgctataaagaagagctggagtgaacacaaaatatacgatctgtacaataaaaatat 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
941447 atcaagctcttcaaagttatagtttttgccagactgctataaagaagagctggagtgaacacaaaatatacgatctgtacaataaaaatat 941357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University