View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3751_low_8 (Length: 294)
Name: NF3751_low_8
Description: NF3751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3751_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 160 - 279
Target Start/End: Original strand, 43588687 - 43588805
Alignment:
| Q |
160 |
gggttggacaactgaaaacaaattttactggcaatagaggttcttcatttattatttcatgacattttagctagtcgtaattattattcattttagctgt |
259 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43588687 |
gggttggacaactgaaa-caaattttactggcaatagaggttcttcatttattatttcattacattttagctagtcgtaattgttattcattttagctgt |
43588785 |
T |
|
| Q |
260 |
tgtgtattcttataagaaag |
279 |
Q |
| |
|
|||||||| ||||||||||| |
|
|
| T |
43588786 |
tgtgtatttttataagaaag |
43588805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 43588528 - 43588622
Alignment:
| Q |
1 |
aagtgtgtggattgaattgtaataggtaaactagttttttcagctgcatttggttggttgcataatcaaagaagcatattcattggatagtaaac |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43588528 |
aagtgtgtggattgaattgtaataggtaaactagttttttcagctgcatttggttggttgcataatcaaagaagcatattcattggatagtaaac |
43588622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University