View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3753_low_9 (Length: 241)
Name: NF3753_low_9
Description: NF3753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3753_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 231
Target Start/End: Original strand, 4006779 - 4006995
Alignment:
| Q |
17 |
aataccaacgccccaaagggcttgaacgccaagcagccaagacaactacaaatgataaaa--atacgaaattgatgcaacactagcagtccagcaagcaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4006779 |
aataccaacgccccaaagggcttgaacgccaagcagccaagacaactacaaatgataaaaaaatacgaaattgatgcaacactagcagtccagcaagcaa |
4006878 |
T |
|
| Q |
115 |
gatacaacgtcaaacggatcccaaaatgccacaacactgcagcagaactagaacatcagagcaggaccggaacagctgaaggtcagaagaaagcaagagc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
4006879 |
gatacaacgtcaaacggatcccaaaatgccacaacactgcagcagaactagaacatcagagcaggactggaacagctgaaggtcagaagaaagcaacagc |
4006978 |
T |
|
| Q |
215 |
tgaacctaacccctttg |
231 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
4006979 |
tgaacctaacccttttg |
4006995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University