View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3754_low_3 (Length: 315)
Name: NF3754_low_3
Description: NF3754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3754_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 13 - 188
Target Start/End: Complemental strand, 19344362 - 19344187
Alignment:
| Q |
13 |
gagaaggcacagttgtataatatcccatctttttcaaatatctttccatcttgctcatgcaatttggtatctttgtagacccctctcttcccataaagct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344362 |
gagaaggcacagttgtataatatcccatctttttcaaatatctttccatcttgctcatgcaatttggtatctttgtagacccctctcttcccataaagct |
19344263 |
T |
 |
| Q |
113 |
tgagctgttaacaatcaccaaattttatcaaacagtcacaagggaagggacctgtatttcttctataaaataatga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19344262 |
tgagctgttaacaatcaccaaattttatcaaacagtcaaaagggaagggacctatatttcttctataaaataatga |
19344187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 199 - 297
Target Start/End: Complemental strand, 19344152 - 19344054
Alignment:
| Q |
199 |
agtatgagagagtagattatgtacttctgctgagagtgattcaatagcctcctccccaggatcttgtttgtcccaagggattccctttccatccacaga |
297 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344152 |
agtatgaaagagtaaattatgtacttctgctgagagtgattcaatagcctcctccccaggatcttgtttgtcccaagggattccctttccatccacaga |
19344054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University