View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3755_low_13 (Length: 280)
Name: NF3755_low_13
Description: NF3755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3755_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 11 - 199
Target Start/End: Complemental strand, 40360058 - 40359870
Alignment:
| Q |
11 |
cacagaagccgtcttgttgctgcaaaagcagcaaattgatcatatactatatgatattattacttgctacgtactaggtattagaagaatgaagcagctt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40360058 |
cacagaagccgtcttgttgctgcaaaagcagcaaattgatcata--ctatatgatattattacttgctacgtactaggtattagaagaatgaagcagctt |
40359961 |
T |
|
| Q |
111 |
gtaataatttcatttttctccctc--nnnnnnnnnnctattactttttagccatttttggcttgtttaatcgattcaattccttatgaatc |
199 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40359960 |
gtaataatttcatttttctccctcttttttttttttctattactttttagccatttttggcttgtttaatcgattcaattccttatgaatc |
40359870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 216 - 280
Target Start/End: Complemental strand, 40359876 - 40359812
Alignment:
| Q |
216 |
atgaatcagaagaattagaccacaacacatggttgtctttgttcattatgtgaaatgcctagtac |
280 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40359876 |
atgaatcagaagaatcagaccacaacacatggttgtctttgttcattatgtgaaatgcctagtac |
40359812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University