View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3755_low_20 (Length: 236)
Name: NF3755_low_20
Description: NF3755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3755_low_20 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 3 - 236
Target Start/End: Complemental strand, 48093424 - 48093187
Alignment:
| Q |
3 |
aaagatagaaaaaacttgcagcaatattaaaatcaa----agcttgctatgtgtttttagaatccaaggctaaaacagtgctgagattcattggatacat |
98 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48093424 |
aaagatagaaaaaacttgcaggaatattaaaatcaatcaaagcttgctatgtgtttttggaatccaaggctaaaacagtgctgagattcattggatacat |
48093325 |
T |
|
| Q |
99 |
ataatctattgtgcctgataaaatctgttgaacaatcaagctgttagccttttcagatggatgaaatgcatcccaaaatgcatattcgtcacggttaggg |
198 |
Q |
| |
|
|||||| |||||||||| || |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48093324 |
ataatcagttgtgcctgacaagatctgttgaacaatcaagctgttagccttttctgaaggatgaaatgcatcccaaaatgcatattcgtcacggttaggg |
48093225 |
T |
|
| Q |
199 |
cataaattagagagtggtgtgcatagcccaagtccatt |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48093224 |
cataaattagatagtggtgtgcatagcccaagtccatt |
48093187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 48102532 - 48102451
Alignment:
| Q |
140 |
tgttagccttttcagatggatgaaatgcatcccaaaatgcatattcgtcacggttagggcataaattagagagtggtgtgca |
221 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||| ||| | | |||||||||||||||||||||||||| |
|
|
| T |
48102532 |
tgtttgccttttcagatggatggaatgcatcccaaaatgcatacaagtctctatctgggcataaattagagagtggtgtgca |
48102451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 48085281 - 48085240
Alignment:
| Q |
140 |
tgttagccttttcagatggatgaaatgcatcccaaaatgcat |
181 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
48085281 |
tgtttgccttttcagatggatggaatgcatcccaaaaagcat |
48085240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 182
Target Start/End: Original strand, 35357725 - 35357764
Alignment:
| Q |
143 |
tagccttttcagatggatgaaatgcatcccaaaatgcata |
182 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35357725 |
tagctttttcagatggatgaaatgcatcccaaaatgcata |
35357764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 149 - 194
Target Start/End: Original strand, 35353607 - 35353652
Alignment:
| Q |
149 |
tttcagatggatgaaatgcatcccaaaatgcatattcgtcacggtt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
35353607 |
tttcagatggatgaaatgcatcccaaaataaatggtcgtcacggtt |
35353652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 7385569 - 7385610
Alignment:
| Q |
140 |
tgttagccttttcagatggatgaaatgcatcccaaaatgcat |
181 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7385569 |
tgtttgccttttcagatggatggaatgcatcccaaaatgcat |
7385610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University