View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3755_low_7 (Length: 425)
Name: NF3755_low_7
Description: NF3755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3755_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 33 - 376
Target Start/End: Complemental strand, 26494356 - 26494013
Alignment:
| Q |
33 |
caataactttctttctggcttgtattagttcaaccaacaaatcattttgcaacttccgaagttgcgtaaattcttgccaacgttttctaaacaacacgcg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26494356 |
caataactttctttctggcttgtattagttcaaccaacaaatcattttgcaacttccgaagttgcgtaaattcttgccaacgttttctaaacaacacgcg |
26494257 |
T |
|
| Q |
133 |
agatacaattttcgggaagaaatttagagcacccaactgtccagagctcaaaatcaaacgtcgctggatgtcttttattttttcaattttcctactatcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26494256 |
agatacaattttcgggaagaaatttagagcacccaactgtccggagctcaaaatcaaacgtctctggatgtcttttattttttcaattttcctactatcc |
26494157 |
T |
|
| Q |
233 |
acattttccccgaaacacatggaaaatagtaagcaaaaaatggcgtgttgaatgtagttgatgagctcaactgaattattcaaaaaatttgcctcaaatt |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26494156 |
acattttccccgaaacacatggaaaatagtaagcaaaaaatggcgtgtcgaatgtagttgatgagctcaactgaattattcaaaaaatttgcctcaaatt |
26494057 |
T |
|
| Q |
333 |
ttaatttgcttataagtgcgtctagtacgcacttacgagctttg |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26494056 |
ttaatttgcttataagtgcgtctagtacgcacttacgagctttg |
26494013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University