View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3756_high_20 (Length: 303)
Name: NF3756_high_20
Description: NF3756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3756_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 52 - 292
Target Start/End: Original strand, 33211546 - 33211786
Alignment:
| Q |
52 |
tggtactgaacagcggtgtggtgatgagggtggcgcacgtgtcagctaggttgtgtcaatacatagcgtgtaatcctgagatgttgggcagcgacgccgt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33211546 |
tggtactgaacagcggtgtggtgatgagggtggcgcacgtgtcagctaggttgtgtcaatacatagcgtgtaatcctgagatgttgagcagcgacgccgt |
33211645 |
T |
|
| Q |
152 |
tttgggtctcatcttttgtcttcctttccaacgtttcttcttctccctttcttcttacctgggttatcctcctattcctcaacactcagattgaacatct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33211646 |
tttgggtctcatcttttgtcttcctttccaacgtttcttcttctccctttcttcttacctgggttatcctcctattcctcaacactcagattgaacatct |
33211745 |
T |
|
| Q |
252 |
tagcttttttgtcgcttaatttctgttgtgtttatgtctct |
292 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33211746 |
tagcttttttgtcgtttaatttctgttgtgtttatgtctct |
33211786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 33211507 - 33211535
Alignment:
| Q |
1 |
ataacatcaatcaaagtacaaagaacgta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33211507 |
ataacatcaatcaaagtacaaagaacgta |
33211535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University