View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3756_high_5 (Length: 359)
Name: NF3756_high_5
Description: NF3756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3756_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 276
Target Start/End: Complemental strand, 13383071 - 13382801
Alignment:
| Q |
11 |
caaaggcaaaggagatcgtgtcttccaatcccgtcgttgttttcaggtaaatcgttttctctcattacttcatctttttt--ctgttgattcattgtttg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||| |||||| ||||||||| |||||||| |
|
|
| T |
13383071 |
caaaggcaaaggagatcgtgtcttccaatcccgtcgtcgttttcaggtaaatccttttctctcattccttcattttttttttctgttgatttattgtttg |
13382972 |
T |
|
| Q |
109 |
taataataacaacgctgatttgtttaattcggtgattgattgattgattgaa---nnnnnnngcagtaaaagctattgtcccttttgcgttcaagtgaag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13382971 |
taataataacaacgctgatttgtttaattcggtgattgattgattgattgaattttttttcttcagcaaaagctattgtcccttttgcgttcaagtgaag |
13382872 |
T |
|
| Q |
206 |
aaactcttcactgatttgggtgtcactttcaaagccgttgaactcgattctgaatgtaagtgctttcacat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13382871 |
aaactcttcactgatttgggtgtcactttcaaagccgttgaactcgattctgaatgtaaatgctttcacat |
13382801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University