View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3757_high_7 (Length: 409)
Name: NF3757_high_7
Description: NF3757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3757_high_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 370 - 409
Target Start/End: Original strand, 48860543 - 48860582
Alignment:
| Q |
370 |
taatcagtgatctgttcatcatcatgctatacgcattgga |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48860543 |
taatcagtgatctgttcatcatcatgctatacgcattgga |
48860582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University