View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3757_low_11 (Length: 239)
Name: NF3757_low_11
Description: NF3757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3757_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 231
Target Start/End: Original strand, 7323258 - 7323473
Alignment:
| Q |
16 |
aaaagtagataataaaagcatatgattgattagaattgatattgtatttgtagtattttgtgttggcttattgtgatagctcacaccgttataagtaaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7323258 |
aaaagtagataataaaagcatatgattgattagaattgatattgtatttgtagtattttgtgttggcttattgtgatagctcacaccattataagtaaat |
7323357 |
T |
|
| Q |
116 |
aatatgtgtggtctcatttgnnnnnnntaaatatataatttctacatggtatcacacgtttttaggttttgcgatccacagatgaacagtacttgcggct |
215 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
7323358 |
aatatgcgtggtctcatttgaaaaaaataaatatataatttctacatggtatcacacgtttttaggttttgcgatccacggatgaacagtatgtgcggct |
7323457 |
T |
|
| Q |
216 |
acttagtgcctttgct |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7323458 |
acttagtgcctttgct |
7323473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 40 - 135
Target Start/End: Original strand, 7307786 - 7307883
Alignment:
| Q |
40 |
attgattagaattgatattgtatttgtagtatt--ttgtgttggcttattgtgatagctcacaccgttataagtaaataatatgtgtggtctcatttg |
135 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||| || | ||| | ||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
7307786 |
attgtttagaattgatattgtatttttagtattgattatattgacctattgtgatagctcacaccattataaataaataatatgtgtggtctcatttg |
7307883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 231
Target Start/End: Original strand, 7307937 - 7308017
Alignment:
| Q |
151 |
taatttctacatggtatcacacgtttttaggttttgcgatccacagatgaacagtacttgcggctacttagtgcctttgct |
231 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||| |||| ||| |||| ||||| |||| | |||||||||||||||| |
|
|
| T |
7307937 |
taatttctacatggtattactcgtttttaagttttcagatcaacatgtgaatagtacgtgcgaccacttagtgcctttgct |
7308017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University