View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3757_low_14 (Length: 209)
Name: NF3757_low_14
Description: NF3757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3757_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 36963237 - 36963044
Alignment:
| Q |
1 |
agttggtaaaatttgtgtataggtgatgtgttccaaaccctcaaaa-cagtaacatgctaaatcgaggataaaaatgtgaagcnnnnnnnggaaaagttt |
99 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36963237 |
agttggtaaaatttgtgtataggtgatttgttccaaaccctcaaaaacagtaacatgctaaatcgaggataaaaatgtgaagcaaaaaaaggaaaagttt |
36963138 |
T |
 |
| Q |
100 |
tgtgaaagacaggacatgaggaggtaatgtgatgaagtggtcggagattaagttgcactgactgaaccaaagatagctagatatcggttacaaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36963137 |
tgtgaaagacaggacatgaggaggtaatgtgataaagtggtcggagattaagttgcactgactgaaccaaagatagctagatatcggttacaaa |
36963044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University