View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3757_low_7 (Length: 409)

Name: NF3757_low_7
Description: NF3757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3757_low_7
NF3757_low_7
[»] chr7 (1 HSPs)
chr7 (370-409)||(48860543-48860582)


Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 370 - 409
Target Start/End: Original strand, 48860543 - 48860582
Alignment:
370 taatcagtgatctgttcatcatcatgctatacgcattgga 409  Q
    ||||||||||||||||||||||||||||||||||||||||    
48860543 taatcagtgatctgttcatcatcatgctatacgcattgga 48860582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University