View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3758_low_8 (Length: 251)
Name: NF3758_low_8
Description: NF3758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3758_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 232
Target Start/End: Original strand, 32313382 - 32313599
Alignment:
| Q |
16 |
aatattaactaaataataaatatagaaaacatgactctacatcgtggtcgtcgttctagagtttcattctggtaaatcgaacgcatctagttgatcaaca |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32313382 |
aatattgactaaataataaatatagaaaacatgactctacatcgtcgtcatcgttttagagtttcattctggtaaatcgaacgcatctagttgatcagca |
32313481 |
T |
 |
| Q |
116 |
ctaaccatcctagagtttcatt-ctagtgaaccgaacgcatctagtttcattctgagtcaatcgacgaacaacgatagtcaaaacttatcatctttcttg |
214 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32313482 |
ctaaccatcctagagtttcattcctagtgaaccgaacgcatctagtttcattatgagtcaatcgacgaacaacgatagtcaaaacttatcatctttcttg |
32313581 |
T |
 |
| Q |
215 |
tgtcattgtggtagagac |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32313582 |
tgtcattgtggtagagac |
32313599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University