View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3759_low_8 (Length: 208)

Name: NF3759_low_8
Description: NF3759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3759_low_8
NF3759_low_8
[»] chr5 (1 HSPs)
chr5 (19-100)||(2501603-2501684)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 2501603 - 2501684
Alignment:
19 cactactatcctcaccaccgctgaaagcagcgacgacaatgatgatgaaggtcctttctttgacttggagtttactgcacct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2501603 cactactatcctcaccaccgctgaaagcagcgacgacaatgatgatgaaggtcctttctttgacttggagtttactgcacct 2501684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University