View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3761_high_33 (Length: 295)
Name: NF3761_high_33
Description: NF3761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3761_high_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 68 - 290
Target Start/End: Complemental strand, 38327086 - 38326864
Alignment:
| Q |
68 |
ggttgagttaggaattgtggactatcaaatttcaatactatgagattgaatcctcataaacttcagcagttacaaattagttattttttcaataattatc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38327086 |
ggttgagttaggaattgtggactatcaaatttcaatactatgagattgaatcctcataaacttcagcagttacaaattagttattttttcaataattatc |
38326987 |
T |
|
| Q |
168 |
tttaacaagtataactgaaaacctttcaataattacattaatgtattttagactatatactggactgttacaaaatgttacttattatttcctgaattta |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38326986 |
tttaacaagtataactgaaaacctttcaataattacattaatttattttagactatatactggactgttacaaaatgttacttattatttcctgaattta |
38326887 |
T |
|
| Q |
268 |
aaaatagggcaacctttgctact |
290 |
Q |
| |
|
||||| |||||||| |||||||| |
|
|
| T |
38326886 |
aaaatggggcaaccattgctact |
38326864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 45 - 89
Target Start/End: Complemental strand, 28401132 - 28401088
Alignment:
| Q |
45 |
ttaacaatttctacatttttatgggttgagttaggaattgtggac |
89 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| | |||||||| |
|
|
| T |
28401132 |
ttaacaatttcaacatttttatggggtgagttagaagttgtggac |
28401088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University