View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3761_high_34 (Length: 290)
Name: NF3761_high_34
Description: NF3761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3761_high_34 |
 |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0044 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 5 - 273
Target Start/End: Original strand, 90775 - 91047
Alignment:
| Q |
5 |
atgatgtaaaacgtacagttagac----tgatgtaattcctagagcataggctgtcgaaaattatgccgtaataccactgcttttacgcacatatatggt |
100 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
90775 |
atgatgtaaaacgtacaattagaccgatcgatgtaatttctagagcataggctgtcgaaaattatgcagtaataccactgcttttacacacatatatggt |
90874 |
T |
 |
| Q |
101 |
cgctgaaattgaaatgtgtaaccactgttggtgctaatttttagtagtgtttgatttgcgtctgttatgcaggtgaacgaatagagaggaaatatatatt |
200 |
Q |
| |
|
| |||||||| ||||||| | ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
90875 |
cactgaaatttaaatgtgcagccaaggttggtgctaatttttaatagtgtttgatttgcgtctgttatgcaggtgaacgaatatagaggaaatatatatt |
90974 |
T |
 |
| Q |
201 |
gataggggatatggcaatggagtagcaacataacattaaaaatgcagaattggtatagtttacaatttgttac |
273 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
90975 |
gatagtggatatcgcaatggagtagcaacataacattaaaaatgcagaattggtatagtttacaatttgttac |
91047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University