View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3761_high_43 (Length: 241)
Name: NF3761_high_43
Description: NF3761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3761_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 82 - 226
Target Start/End: Complemental strand, 45603120 - 45602976
Alignment:
| Q |
82 |
gtttatatttttattttcttggggtattgagttttcttcttcatctcgaaaatgtggtgggaaaaagttgaggtgaaagcgttgaacggaaaagaagatt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45603120 |
gtttatatttttattttcttggggtattgagttttcttcttcatctcgaaaatgtggtgggaaaaagttgaggtgaaaacgttgaacggaaaagaagatt |
45603021 |
T |
 |
| Q |
182 |
ctggtggagatgggccagggaaaaggtggggtcatacttgtaact |
226 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45603020 |
ctggtggagatgggccagggaagaggtggggtcatacttgtaact |
45602976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 45603208 - 45603151
Alignment:
| Q |
1 |
tctcatttctttcgatttcaccctctaccccacacacccaattttttcttttcaaatt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
45603208 |
tctcatttctttcgatttcaccctctaccccacatacccatttttttcttttcaaatt |
45603151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University