View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3761_high_45 (Length: 239)
Name: NF3761_high_45
Description: NF3761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3761_high_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 106 - 221
Target Start/End: Complemental strand, 31796178 - 31796063
Alignment:
| Q |
106 |
gagtgataacttaaaaaggattgggatgcaggaactatacagactaggaggtagaaggattggagtatttgatgtaccagttatagggtgtgtgccctca |
205 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31796178 |
gagtgataacttaaaaaggattggggtgcaggaactatacagactaggaggtagaaggattggagtatttgatgtaccagttatagggtgtgtgccctca |
31796079 |
T |
|
| Q |
206 |
caaagaacacttggtg |
221 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31796078 |
caaagaacacttggtg |
31796063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 31796283 - 31796243
Alignment:
| Q |
1 |
atgtatactatacactaagaatatgaaacatgaatgtacta |
41 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31796283 |
atgtctactatacactaagaatatgaaacatgaatctacta |
31796243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 134 - 219
Target Start/End: Original strand, 8939329 - 8939414
Alignment:
| Q |
134 |
caggaactatacagactaggaggtagaaggattggagtatttgatgtaccagttatagggtgtgtgccctcacaaagaacacttgg |
219 |
Q |
| |
|
||||||||||| | |||||| |||||||||||||||| ||| | | ||| ||||||||||||||||||||| |||||| |||| |
|
|
| T |
8939329 |
caggaactatatggtttaggagctagaaggattggagtaattggtatgccaaatatagggtgtgtgccctcacagagaacaattgg |
8939414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University