View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3761_low_1 (Length: 683)
Name: NF3761_low_1
Description: NF3761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3761_low_1 |
 |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0016 (Bit Score: 71; Significance: 8e-32; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 477 - 563
Target Start/End: Complemental strand, 47021 - 46935
Alignment:
| Q |
477 |
ttatctttttatctgaaccattacagtgcagccatagaagaaacatatgttaggtaacttgtttagtgtgtacataatatttgtccg |
563 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| | |||||||||||||| |
|
|
| T |
47021 |
ttatctttttatctgaaccattacagtgcagccatagaagaaacatatgttaggcagcttgtttagtgtgcagataatatttgtccg |
46935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 625 - 678
Target Start/End: Complemental strand, 46913 - 46861
Alignment:
| Q |
625 |
ctgcttgtgtctctggcaagataaagccaccagcagattttgtgactcttatct |
678 |
Q |
| |
|
||||||| |||||||||| ||||||| | ||||||||||||||| ||||||||| |
|
|
| T |
46913 |
ctgcttgcgtctctggca-gataaagtctccagcagattttgtggctcttatct |
46861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 67; Significance: 2e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 392 - 513
Target Start/End: Original strand, 33714973 - 33715095
Alignment:
| Q |
392 |
ttgtagatagtatatagagctatggctatgttacatgaaaaa-gttttcctttcatatcgttgagtttatagatggaaatgttaatttatctttttatct |
490 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| | ||| |||||| || |||||| |||||||||| || |||||||||| ||||| || |
|
|
| T |
33714973 |
ttgtagatagtatatagagctatggctatgttacataaaaaaaggtttactttcaaattgttgagcttatagatggcaaggttaatttattgttttaact |
33715072 |
T |
 |
| Q |
491 |
gaaccattacagtgcagccatag |
513 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
33715073 |
gaaccattgcagtgcagccatag |
33715095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 295 - 373
Target Start/End: Original strand, 43206799 - 43206878
Alignment:
| Q |
295 |
tttgtatatatagatgttgtattgaacctttccaattaatgaaacaatgag-attcattaatttctctcaatttataata |
373 |
Q |
| |
|
||||| |||||| |||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||| |
|
|
| T |
43206799 |
tttgtgtatatacatgttgtactgaacctttccaattaatgaaacaatgagtattcattcatttctctcaattcataata |
43206878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University