View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3761_low_28 (Length: 353)
Name: NF3761_low_28
Description: NF3761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3761_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 18 - 345
Target Start/End: Complemental strand, 41378849 - 41378519
Alignment:
| Q |
18 |
gtaagttcagcggaggagatttttgatgagattaaagtgttgacgtggaggtggagcctttctagaataaatattccgtcgtgtctgtattacgaatggt |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
41378849 |
gtaagttcaacggaggagatttttgatgagattaaagtgttgatgtggaggtggagcctttctagaataaatatttcgtcgtgtctgtattatgaatggt |
41378750 |
T |
 |
| Q |
118 |
gctagaatctgagattttgcctccgtgtgtagggtcggtggcagttggggagtgtggggtttttggtgtgtagtaggttgttctggtgtttggcccttct |
217 |
Q |
| |
|
||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||| |
|
|
| T |
41378749 |
gctggaattcgagattttgcctccgtgtgtagggtcggtggcagttggggagtgtggggtttttggtgtgtgggaggttgttttggtgtttggcccttct |
41378650 |
T |
 |
| Q |
218 |
gctggtaccttgcagctgctggggttgctgatgttgttatgcagttgtggctgttttgctggtatagtgcagctgctg---ctgtatttttgctgcagtt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41378649 |
gctggtaccttgcagctgctggggttgctgctgttgttatgcagttgtggctgttttgctggtatagtgcagctgctgcttctgtatttttgctgcagtt |
41378550 |
T |
 |
| Q |
315 |
tgctgcacttaagtgggtgttttcctttgct |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41378549 |
tgctgcacttaagtgggtgttttcctttgct |
41378519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University